Loading...
piRBase Id | piR-hsa-30842 | Accession | DQ600642 |
---|---|---|---|
Organism | Human | Number of methods | 1 |
Sequence | TACTTACTCTGAGATCACCCGTTTGC | Number of papers | 2 |
Length | 26 | Golden piRNA | - |
Aliases | piR-38708; PIR61753; |
Dataset | Accession | Reads | PubMed | Method | Tissue |
---|---|---|---|---|---|
1 | N/A | N/A | 16751776 | small RNA | testis |
430 | GSM2067753 | 3 | 27068805 | small RNA | Seminal plasma(fertile healthy) |
No. | Location | Gene | RepeatMaker |
---|---|---|---|
Location 1 | 2:131408014-131408040:+ | LINC01120 ENST00000437751; LINC01120 ENST00000663072; LINC01120 ENST00000668661; LINC01120 ENST00000669881; LINC01120 ENST00000664380; LINC01120 ENST00000671275; LINC01120 ENST00000671078; LINC01120 ENST00000662267; LINC01120 ENST00000670748; LINC01120 ENST00000666196; |
No record. |
No record. |
No record. |
No record. |
No record. |
PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
---|---|---|---|
Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. |
PubMed | 27068805 | Journal | Sci Rep. 2016 Apr 12;6:24229. doi: 10.1038/srep24229. |
---|---|---|---|
Title | Systematic characterization of seminal plasma piRNAs as molecular biomarkers for male infertility. | ||
Authors | Hong Y, Wang C, Fu Z, Liang H, Zhang S, Lu M, Sun W, Ye C, Zhang CY, Zen K, Shi L, Zhang C, Chen X. |