Loading...

Detail Information of piRNA: piR-hsa-30838

General Information
piRBase Id piR-hsa-30838 Accession DQ600638
Organism Human Number of methods 2
Sequence TACTGTTTGGATAGGTGAAAGTTGAGCAC Number of papers 3
Length 29 Golden piRNA -
Aliases piR-38704; PIR61749;
Datasets
Dataset Accession Reads PubMed Method Tissue
1 N/A N/A 16751776 small RNA testis
169 GSM1584523 2 25818294 oxidized small RNA adult ovary
270 GSM3517639 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult)
277 GSM3517647 N/A 31358756 samll RNA(CAS-seq) morula embryo(age: adult; spike in)
Location in GRCh38
1 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 6:40159019-40159048:-
piRNA Expression
Sample CPM
GSM1584521 0
GSM1584522 0
GSM1584523 1.9036
GSM1584524 0
GSM1584525 0
GSM1584526 0
Sample CPM
GSM1584527 0
GSM1584528 0
GSM1584529 0
GSM1584530 0
GSM1584531 0
GSM1584532 0
The Expression of piRNA: piR-hsa-30838
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 25818294 Journal Cell Rep. 2015 Mar 31;10(12):2069-82.
Title Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.
PubMed 31358756 Journal Nat Commun. 2019 Jul 29;10(1):3389. doi: 10.1038/s41467-019-11312-8.
Title Single-cell CAS-seq reveals a class of short PIWI-interacting RNAs in human oocytes.
Authors Yang Q, Li R, Lyu Q, Hou L, Liu Z, Sun Q, Liu M, Shi H, Xu B, Yin M, Yan Z,Huang Y, Liu M, Li Y, Wu L.