Loading...

Detail Information of piRNA: piR-hsa-306779

General Information
piRBase Id piR-hsa-306779 Accession N/A
Organism Human Number of methods 1
Sequence TAGCTAAAGCTCTTGCACATGATG Number of papers 1
Length 24 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
168 GSM1584522 1 25818294 small RNA adult ovary
Location in GRCh38
1 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 1:1561701-1561725:- SSU72 ENST00000291386; SSU72 ENST00000378725; SSU72 ENST00000359060;
piRNA Expression
Sample CPM
GSM1584521 0
GSM1584522 0.6903
GSM1584523 0
GSM1584524 0
GSM1584525 0
GSM1584526 0
Sample CPM
GSM1584527 0
GSM1584528 0
GSM1584529 0
GSM1584530 0
GSM1584531 0
GSM1584532 0
The Expression of piRNA: piR-hsa-306779
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 25818294 Journal Cell Rep. 2015 Mar 31;10(12):2069-82.
Title Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.