Loading...

Detail Information of piRNA: piR-hsa-30386

General Information
piRBase Id piR-hsa-30386 Accession DQ600186
Organism Human Number of methods 2
Sequence TACCATGTCTGGACGTGGCAAGCAGG Number of papers 2
Length 26 Golden piRNA Y
Aliases piR-38252; PIR61297;
Datasets
Dataset Accession Reads PubMed Method Tissue
1 N/A N/A 16751776 small RNA testis
173 GSM1584527 1 25818294 oxidized small RNA ovary from 1st trimester embryos
174 GSM1584528 1 25818294 oxidized small RNA ovary from 1st trimester embryos
175 GSM1584529 87 25818294 small RNA ovary from 2nd trimester embryos
176 GSM1584530 19 25818294 small RNA ovary from 2nd trimester embryos
177 GSM1584531 797 25818294 oxidized small RNA ovary from 2nd trimester embryos
178 GSM1584532 52 25818294 oxidized small RNA ovary from 2nd trimester embryos
Location in GRCh38
1 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 6:27893127-27893153:- H2AC17 ENST00000359611;
piRNA Expression
Sample CPM
GSM1584521 0
GSM1584522 0
GSM1584523 0
GSM1584524 0
GSM1584525 0
GSM1584526 0
Sample CPM
GSM1584527 1.4384
GSM1584528 106.4623
GSM1584529 38.6925
GSM1584530 9.3266
GSM1584531 97.8686
GSM1584532 65.2339
The Expression of piRNA: piR-hsa-30386
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 25818294 Journal Cell Rep. 2015 Mar 31;10(12):2069-82.
Title Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.