Loading...

Detail Information of piRNA: piR-hsa-303

General Information
piRBase Id piR-hsa-303 Accession DQ569979
Organism Human Number of methods 2
Sequence AAAGTGAGGAGCGTCTCCGCCCGGCCGCC Number of papers 3
Length 29 Golden piRNA -
Aliases piR-30091; PIR31090;
Datasets
Dataset Accession Reads PubMed Method Tissue
1 N/A N/A 16751776 small RNA testis
176 GSM1584530 1 25818294 small RNA ovary from 2nd trimester embryos
177 GSM1584531 1 25818294 oxidized small RNA ovary from 2nd trimester embryos
301 GSM2222675 N/A 29516567 small RNA neuroblastoma cell lines (SH-SY-5Y)
Location in GRCh38
205 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 17:42972828-42972857:+ PTGES3L-AARSD1 ENST00000360221; PTGES3L-AARSD1 ENST00000409399; PTGES3L-AARSD1 ENST00000409103; PTGES3L-AARSD1 ENST00000421990; PTGES3L-AARSD1 ENST00000423601; PTGES3L-AARSD1 ENST00000452752; PTGES3L-AARSD1 ENST00000454303; PTGES3L ENST00000424284; PTGES3L ENST00000591916; PTGES3L ENST00000409446; PTGES3L ENST00000462157; PTGES3L ENST00000451885; Retroposon SVA SVA_F;
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
Sample CPM
GSM1584521 0
GSM1584522 0
GSM1584523 0
GSM1584524 0
GSM1584525 0
GSM1584526 0
Sample CPM
GSM1584527 0
GSM1584528 0
GSM1584529 0
GSM1584530 0.4909
GSM1584531 0.1228
GSM1584532 0
The Expression of piRNA: piR-hsa-303
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 25818294 Journal Cell Rep. 2015 Mar 31;10(12):2069-82.
Title Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.
PubMed 29516567 Journal Genes Chromosomes Cancer. 2018 Jul;57(7):339-349. doi: 10.1002/gcc.22535.
Title Investigating piwi-interacting RNA regulome in human neuroblastoma.
Authors Roy J, Mallick B.