Loading...

Detail Information of piRNA: piR-hsa-28877

General Information
piRBase Id piR-hsa-28877 Accession DQ598677
Organism Human Number of methods 1
Sequence GTTTCCGTAGTGTAGTGGTCATCACGTTCGCC Number of papers 5
Length 32 Golden piRNA -
Aliases piR-36743; PIR59788;
Datasets
Dataset Accession Reads PubMed Method Tissue
1 N/A N/A 16751776 small RNA testis
300 GSM2222674 1000 29516567 small RNA neuroblastoma cell lines (IMR-32)
301 GSM2222675 5886 29516567 small RNA neuroblastoma cell lines (SH-SY-5Y)
302 GSM4585035 2134 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
303 GSM4585036 2519 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
304 GSM4585037 1421 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
305 GSM4585038 3650 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
306 GSM4585039 2448 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
307 GSM4585040 1577 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
308 GSM4585041 57396 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
309 GSM4585042 7565 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
310 GSM4585043 4490 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
311 GSM4585044 1554 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
312 GSM4585045 3675 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
313 GSM4585046 2273 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
314 GSM4585047 468 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioma, Grade II-III astrocytoma)
315 GSM4585048 334 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioma, Grade II-III astrocytoma)
316 GSM4585049 1027 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioma, Grade II-III astrocytoma)
317 GSM4585050 230 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioma, Grade II-III astrocytoma)
318 GSM4585051 384 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioma, Grade II-III astrocytoma)
320 GSM4020157 4576 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Monolayer culture control
321 GSM4020158 5105 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Monolayer culture control
322 GSM4020159 7553 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Monolayer culture control
323 GSM4020160 5532 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Monolayer culture control
324 GSM4020161 6131 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Femal; Monolayer culture contro
325 GSM4020162 5420 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Monolayer culture contr
326 GSM4020163 7173 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Osteogenic differentiatio
327 GSM4020164 6182 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Osteogenic differentiatio
328 GSM4020165 7239 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Osteogenic differentiatio
329 GSM4020166 6186 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Osteogenic differentiatio
330 GSM4020167 6888 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Osteogenic differentiat
331 GSM4020168 6118 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Osteogenic differentiat
332 GSM4020169 3483 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Pellet culture control (d
333 GSM4020170 11509 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Pellet culture control (d
334 GSM4020171 6357 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Pellet culture control (d
335 GSM4020172 6257 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Pellet culture control (d
336 GSM4020173 8362 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Pellet culture control
337 GSM4020174 7547 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Pellet culture control
338 GSM4020175 7093 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Chondrogenic differentiat
339 GSM4020176 11447 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Chondrogenic differentiat
340 GSM4020177 3856 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Chondrogenic differentiat
341 GSM4020178 6385 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Chondrogenic differentiat
342 GSM4020179 2572 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Chondrogenic differenti
343 GSM4020180 2440 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Chondrogenic differenti
430 GSM2067753 489 27068805 small RNA Seminal plasma(fertile healthy)
431 GSM2067754 563 27068805 small RNA Seminal plasma(asthenozoospermia)
432 GSM2067755 466 27068805 small RNA Seminal plasma(azoospermia)
Location in GRCh38
1 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 5:181188456-181188488:- LINC01962 ENST00000658296; LINC01962 ENST00000655600; tRNA tRNA tRNA-Val-GTY;
piRNA Expression
No record.
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
Id in article Disease Subtype Expression Function PubMed
piR-36743 Breast cancer up-regulated 25313140
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 29516567 Journal Genes Chromosomes Cancer. 2018 Jul;57(7):339-349. doi: 10.1002/gcc.22535.
Title Investigating piwi-interacting RNA regulome in human neuroblastoma.
Authors Roy J, Mallick B.
PubMed 32668808 Journal Int J Mol Sci. 2020 Jul 13;21(14):4954. doi: 10.3390/ijms21144954.
Title Deep Sequencing of Small RNAs from Neurosurgical Extracellular Vesicles Substantiates miR-486-3p as a Circulating Biomarker that Distinguishes Glioblastoma from Lower-Grade Astrocytoma Patients.
Authors Hallal S, Ebrahim Khani S, Wei H, Lee MYT, Sim HW, Sy J, Shivalingam B, Buckland ME, Alexander-Kaufman KL.
PubMed 32050423 Journal Cells. 2020 Feb 9;9(2):398. doi: 10.3390/cells9020398.
Title Differential Regulation of circRNA, miRNA, and piRNA during Early Osteogenic and Chondrogenic Differentiation of Human Mesenchymal Stromal Cells.
Authors Della Bella E, Menzel U, Basoli V, Tourbier C, Alini M, Stoddart MJ.
PubMed 27068805 Journal Sci Rep. 2016 Apr 12;6:24229. doi: 10.1038/srep24229.
Title Systematic characterization of seminal plasma piRNAs as molecular biomarkers for male infertility.
Authors Hong Y, Wang C, Fu Z, Liang H, Zhang S, Lu M, Sun W, Ye C, Zhang CY, Zen K, Shi L, Zhang C, Chen X.
PubMed 25313140 Journal Oncotarget. 2014 Oct 30;5(20):9901-10.
Title RNA sequencing identifies specific PIWI-interacting small non-coding RNA expression patterns in breast cancer
Authors Hashim A, Rizzo F, Marchese G, Ravo M, Tarallo R, Nassa G, Giurato G, Santamaria G, Cordella A, Cantarella C, Weisz A.