Loading...

Detail Information of piRNA: piR-hsa-2861601

General Information
piRBase Id piR-hsa-2861601 Accession N/A
Organism Human Number of methods 1
Sequence AAGATTTCCGTGGAGAGGAACGAG Number of papers 1
Length 24 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
173 GSM1584527 1 25818294 oxidized small RNA ovary from 1st trimester embryos
Location in GRCh38
1 best hit(s) with 1 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 1:11908198-11908222:+ ENSG00000285646 ENST00000661075; ENSG00000285646 ENST00000649268; ENSG00000285646 ENST00000650448; ENSG00000285646 ENST00000666735; ENSG00000285646 ENST00000660618; ENSG00000285646 ENST00000658167; RNU5E-1 ENST00000362477; snRNA snRNA U5;
piRNA Expression
The Expression of piRNA: piR-hsa-2861601
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 25818294 Journal Cell Rep. 2015 Mar 31;10(12):2069-82.
Title Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.