Loading...
| piRBase Id | piR-hsa-2839185 | Accession | N/A |
|---|---|---|---|
| Organism | Human | Number of methods | 2 |
| Sequence | CCTCAGTAAGTTGCAATACTTAATTTCTGCC | Number of papers | 1 |
| Length | 31 | Golden piRNA | Y |
| Aliases | N/A | ||
| Dataset | Accession | Reads | PubMed | Method | Tissue |
|---|---|---|---|---|---|
| 173 | GSM1584527 | 4 | 25818294 | oxidized small RNA | ovary from 1st trimester embryos |
| 175 | GSM1584529 | 4 | 25818294 | small RNA | ovary from 2nd trimester embryos |
| 177 | GSM1584531 | 1 | 25818294 | oxidized small RNA | ovary from 2nd trimester embryos |
| No. | Location | Gene | RepeatMaker |
|---|---|---|---|
| Location 1 | 1:630720-630751:+ | ENSG00000230021 ENST00000419394; ENSG00000230021 ENST00000634337; ENSG00000230021 ENST00000635509; ENSG00000230021 ENST00000648019; ENSG00000230021 ENST00000440200; ENSG00000230021 ENST00000440196; ENSG00000230021 ENST00000641296; ENSG00000230021 ENST00000452176; |
| Sample | CPM |
|---|---|
| GSM1584521 | 0 |
| GSM1584522 | 0 |
| GSM1584523 | 0 |
| GSM1584524 | 0 |
| GSM1584525 | 0 |
| GSM1584526 | 0 |
| Sample | CPM |
|---|---|
| GSM1584527 | 5.7535 |
| GSM1584528 | 0 |
| GSM1584529 | 1.779 |
| GSM1584530 | 0 |
| GSM1584531 | 0.1228 |
| GSM1584532 | 0 |
| No record. |
| No record. |
| No record. |
| No record. |
| PubMed | 25818294 | Journal | Cell Rep. 2015 Mar 31;10(12):2069-82. |
|---|---|---|---|
| Title | Piwi proteins and piRNAs in mammalian oocytes and early embryos. | ||
| Authors | Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF. | ||