Loading...

Detail Information of piRNA: piR-hsa-28374

General Information
piRBase Id piR-hsa-28374 Accession DQ598159
Organism Human Number of methods 1
Sequence GGGGATGTAGCTCAGTGGTAGAGCGCATGCT Number of papers 6
Length 31 Golden piRNA -
Aliases piR-36225; PIR59270;
Datasets
Dataset Accession Reads PubMed Method Tissue
1 N/A N/A 16751776 small RNA testis
289 GSM1386593 3755 26095918 samll RNA Lung(cell line: HBE2; cell type: Immortalized bronchial epithelial)
290 GSM1386594 1342 26095918 samll RNA Lung(cell line: HBE3; cell type: Immortalized bronchial epithelial)
291 GSM1386595 1585 26095918 samll RNA Lung(cell line: HBE4; cell type: Immortalized bronchial epithelial)
292 GSM1386596 1348 26095918 samll RNA Lung(cell line: H522; cell type: Adenocarcinoma (NSCLC))
293 GSM1386597 1684 26095918 samll RNA Lung(cell line: H1437; cell type: Adenocarcinoma (NSCLC))
294 GSM1386598 283 26095918 samll RNA Lung(cell line: H1792; cell type: Adenocarcinoma (NSCLC))
295 GSM1386599 193 26095918 samll RNA Lung(cell line: H1944; cell type: Adenocarcinoma (NSCLC))
296 GSM1386600 226 26095918 samll RNA Lung(cell line: H157; cell type: Squamous (NSCLC))
297 GSM1386601 12561 26095918 samll RNA Lung(cell line: H226; cell type: Squamous (NSCLC))
298 GSM1386602 436 26095918 samll RNA Lung(cell line: H596; cell type: Squamous (NSCLC))
299 GSM1386603 1255 26095918 samll RNA Lung(cell line: SKMES1; cell type: Squamous (NSCLC))
300 GSM2222674 283 29516567 small RNA neuroblastoma cell lines (IMR-32)
301 GSM2222675 1517 29516567 small RNA neuroblastoma cell lines (SH-SY-5Y)
302 GSM4585035 566 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
303 GSM4585036 1272 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
304 GSM4585037 499 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
305 GSM4585038 3481 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
306 GSM4585039 330 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
307 GSM4585040 173 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
308 GSM4585041 618 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
309 GSM4585042 474 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
310 GSM4585043 1009 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
311 GSM4585044 727 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
312 GSM4585045 788 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
313 GSM4585046 573 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
314 GSM4585047 303 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioma, Grade II-III astrocytoma)
315 GSM4585048 553 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioma, Grade II-III astrocytoma)
316 GSM4585049 332 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioma, Grade II-III astrocytoma)
317 GSM4585050 283 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioma, Grade II-III astrocytoma)
318 GSM4585051 316 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioma, Grade II-III astrocytoma)
320 GSM4020157 1146 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Monolayer culture control
321 GSM4020158 2027 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Monolayer culture control
322 GSM4020159 1963 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Monolayer culture control
323 GSM4020160 1736 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Monolayer culture control
324 GSM4020161 1332 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Femal; Monolayer culture contro
325 GSM4020162 1695 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Monolayer culture contr
326 GSM4020163 1545 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Osteogenic differentiatio
327 GSM4020164 1003 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Osteogenic differentiatio
328 GSM4020165 2295 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Osteogenic differentiatio
329 GSM4020166 1750 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Osteogenic differentiatio
330 GSM4020167 1653 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Osteogenic differentiat
331 GSM4020168 1607 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Osteogenic differentiat
332 GSM4020169 347 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Pellet culture control (d
333 GSM4020170 757 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Pellet culture control (d
334 GSM4020171 740 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Pellet culture control (d
335 GSM4020172 765 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Pellet culture control (d
336 GSM4020173 953 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Pellet culture control
337 GSM4020174 1266 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Pellet culture control
338 GSM4020175 1516 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Chondrogenic differentiat
339 GSM4020176 1883 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Chondrogenic differentiat
340 GSM4020177 797 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Chondrogenic differentiat
341 GSM4020178 1327 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Chondrogenic differentiat
342 GSM4020179 815 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Chondrogenic differenti
343 GSM4020180 568 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Chondrogenic differenti
430 GSM2067753 283 27068805 small RNA Seminal plasma(fertile healthy)
431 GSM2067754 211 27068805 small RNA Seminal plasma(asthenozoospermia)
432 GSM2067755 206 27068805 small RNA Seminal plasma(azoospermia)
Location in GRCh38
10 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 12:124921795-124921826:- tRNA tRNA tRNA-Ala-GCG;
Location 2 12:124939965-124939996:+ tRNA tRNA tRNA-Ala-GCG;
Location 3 5:181206867-181206898:+ tRNA tRNA tRNA-Ala-GCG;
Location 4 6:26553502-26553533:+ tRNA tRNA tRNA-Ala-GCG;
Location 5 6:28643444-28643475:+ ENSG00000287279 ENST00000653211; tRNA tRNA tRNA-Ala-GCG;
Location 6 6:28658277-28658308:- tRNA tRNA tRNA-Ala-GCY_;
Location 7 6:28673876-28673907:- tRNA tRNA tRNA-Ala-GCG;
Location 8 CHR_HSCHR6_MHC_COX_CTG1:28643400-28643431:+
Location 9 CHR_HSCHR6_MHC_COX_CTG1:28658237-28658268:-
Location 10 CHR_HSCHR6_MHC_COX_CTG1:28673831-28673862:-
piRNA Expression
No record.
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
Id in article Disease Subtype Expression Function PubMed
piR-20485 breast cancer up-regulated FC 5.12 23229900
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 26095918 Journal Nat Commun. 2015 Jun 22;6:7316. doi: 10.1038/ncomms8316.
Title A piRNA-like small RNA interacts with and modulates p-ERM proteins in human somatic cells.
Authors Mei Y, Wang Y, Kumari P, Shetty AC, Clark D, Gable T, MacKerell AD, Ma MZ, Weber DJ, Yang AJ, Edelman MJ, Mao L.
PubMed 29516567 Journal Genes Chromosomes Cancer. 2018 Jul;57(7):339-349. doi: 10.1002/gcc.22535.
Title Investigating piwi-interacting RNA regulome in human neuroblastoma.
Authors Roy J, Mallick B.
PubMed 32668808 Journal Int J Mol Sci. 2020 Jul 13;21(14):4954. doi: 10.3390/ijms21144954.
Title Deep Sequencing of Small RNAs from Neurosurgical Extracellular Vesicles Substantiates miR-486-3p as a Circulating Biomarker that Distinguishes Glioblastoma from Lower-Grade Astrocytoma Patients.
Authors Hallal S, Ebrahim Khani S, Wei H, Lee MYT, Sim HW, Sy J, Shivalingam B, Buckland ME, Alexander-Kaufman KL.
PubMed 32050423 Journal Cells. 2020 Feb 9;9(2):398. doi: 10.3390/cells9020398.
Title Differential Regulation of circRNA, miRNA, and piRNA during Early Osteogenic and Chondrogenic Differentiation of Human Mesenchymal Stromal Cells.
Authors Della Bella E, Menzel U, Basoli V, Tourbier C, Alini M, Stoddart MJ.
PubMed 27068805 Journal Sci Rep. 2016 Apr 12;6:24229. doi: 10.1038/srep24229.
Title Systematic characterization of seminal plasma piRNAs as molecular biomarkers for male infertility.
Authors Hong Y, Wang C, Fu Z, Liang H, Zhang S, Lu M, Sun W, Ye C, Zhang CY, Zen K, Shi L, Zhang C, Chen X.
PubMed 23229900 Journal Clin Transl Oncol. 2013 Jul;15(7):563-8. doi: 10.1007/s12094-012-0966-0. Epub 2012 Nov 15.
Title Altered expression of piRNAs and their relation with clinicopathologic features of breast cancer.
Authors Huang G, Hu H, Xue X, Shen S, Gao E, Guo G, Shen X, Zhang X.