Loading...
piRBase Id | piR-hsa-28175 | Accession | DQ597960 |
---|---|---|---|
Organism | Human | Number of methods | 1 |
Sequence | GGCCCCATGGTGTAATGGTCAGCACTC | Number of papers | 3 |
Length | 27 | Golden piRNA | - |
Aliases | piR-36026; PIR59071; |
Dataset | Accession | Reads | PubMed | Method | Tissue |
---|---|---|---|---|---|
1 | N/A | N/A | 16751776 | small RNA | testis |
289 | GSM1386593 | 140 | 26095918 | samll RNA | Lung(cell line: HBE2; cell type: Immortalized bronchial epithelial) |
290 | GSM1386594 | 76 | 26095918 | samll RNA | Lung(cell line: HBE3; cell type: Immortalized bronchial epithelial) |
291 | GSM1386595 | 61 | 26095918 | samll RNA | Lung(cell line: HBE4; cell type: Immortalized bronchial epithelial) |
292 | GSM1386596 | 43 | 26095918 | samll RNA | Lung(cell line: H522; cell type: Adenocarcinoma (NSCLC)) |
293 | GSM1386597 | 64 | 26095918 | samll RNA | Lung(cell line: H1437; cell type: Adenocarcinoma (NSCLC)) |
294 | GSM1386598 | 41 | 26095918 | samll RNA | Lung(cell line: H1792; cell type: Adenocarcinoma (NSCLC)) |
295 | GSM1386599 | 34 | 26095918 | samll RNA | Lung(cell line: H1944; cell type: Adenocarcinoma (NSCLC)) |
296 | GSM1386600 | 118 | 26095918 | samll RNA | Lung(cell line: H157; cell type: Squamous (NSCLC)) |
297 | GSM1386601 | 101 | 26095918 | samll RNA | Lung(cell line: H226; cell type: Squamous (NSCLC)) |
298 | GSM1386602 | 103 | 26095918 | samll RNA | Lung(cell line: H596; cell type: Squamous (NSCLC)) |
299 | GSM1386603 | 70 | 26095918 | samll RNA | Lung(cell line: SKMES1; cell type: Squamous (NSCLC)) |
300 | GSM2222674 | N/A | 29516567 | small RNA | neuroblastoma cell lines (IMR-32) |
301 | GSM2222675 | N/A | 29516567 | small RNA | neuroblastoma cell lines (SH-SY-5Y) |
No. | Location | Gene | RepeatMaker |
---|---|---|---|
Location 1 | 6:27791400-27791427:- | tRNA tRNA tRNA-Gln-CAA; |
No record. |
No record. |
No record. |
No record. |
Id in article | Disease | Subtype | Expression | Function | PubMed |
---|---|---|---|---|---|
piR-36026 | Breast cancer | up-regulated | 25313140 |
PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
---|---|---|---|
Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. |
PubMed | 26095918 | Journal | Nat Commun. 2015 Jun 22;6:7316. doi: 10.1038/ncomms8316. |
---|---|---|---|
Title | A piRNA-like small RNA interacts with and modulates p-ERM proteins in human somatic cells. | ||
Authors | Mei Y, Wang Y, Kumari P, Shetty AC, Clark D, Gable T, MacKerell AD, Ma MZ, Weber DJ, Yang AJ, Edelman MJ, Mao L. |
PubMed | 29516567 | Journal | Genes Chromosomes Cancer. 2018 Jul;57(7):339-349. doi: 10.1002/gcc.22535. |
---|---|---|---|
Title | Investigating piwi-interacting RNA regulome in human neuroblastoma. | ||
Authors | Roy J, Mallick B. |
PubMed | 25313140 | Journal | Oncotarget. 2014 Oct 30;5(20):9901-10. |
---|---|---|---|
Title | RNA sequencing identifies specific PIWI-interacting small non-coding RNA expression patterns in breast cancer | ||
Authors | Hashim A, Rizzo F, Marchese G, Ravo M, Tarallo R, Nassa G, Giurato G, Santamaria G, Cordella A, Cantarella C, Weisz A. |