Loading...

Detail Information of piRNA: piR-hsa-28088

General Information
piRBase Id piR-hsa-28088 Accession DQ597858
Organism Human Number of methods 1
Sequence GGCACAGAGCAGGCTAGGTCTGCCGCGA Number of papers 1
Length 28 Golden piRNA -
Aliases piR-35924; PIR58969;
Datasets
Dataset Accession Reads PubMed Method Tissue
1 N/A N/A 16751776 small RNA testis
Location in GRCh38
1 best hit(s) with 1 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 1:1564224-1564252:- SSU72 ENST00000291386; SSU72 ENST00000378725; SSU72 ENST00000359060;
piRNA Expression
No record.
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
Id in article Disease Subtype Expression Function PubMed
DQ597858 Bladder cancer down-regulated FC 3.3 25305452
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 25305452 Journal Cancer Lett. 2015 Jan 28;356(2 Pt B):561-7. doi: 10.1016/j.canlet.2014.10.004. Epub 2014 Oct 8.
Title Identification of novel piRNAs in bladder cancer
Authors Chu H, Hui G, Yuan L, Shi D, Wang Y, Du M, Zhong D, Ma L, Tong N, Qin C, Yin C, Zhang Z, Wang M.