Loading...
piRBase Id | piR-hsa-28088 | Accession | DQ597858 |
---|---|---|---|
Organism | Human | Number of methods | 1 |
Sequence | GGCACAGAGCAGGCTAGGTCTGCCGCGA | Number of papers | 1 |
Length | 28 | Golden piRNA | - |
Aliases | piR-35924; PIR58969; |
No. | Location | Gene | RepeatMaker |
---|---|---|---|
Location 1 | 1:1564224-1564252:- | SSU72 ENST00000291386; SSU72 ENST00000378725; SSU72 ENST00000359060; |
No record. |
No record. |
No record. |
No record. |
Id in article | Disease | Subtype | Expression | Function | PubMed |
---|---|---|---|---|---|
DQ597858 | Bladder cancer | down-regulated FC 3.3 | 25305452 |
PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
---|---|---|---|
Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. |
PubMed | 25305452 | Journal | Cancer Lett. 2015 Jan 28;356(2 Pt B):561-7. doi: 10.1016/j.canlet.2014.10.004. Epub 2014 Oct 8. |
---|---|---|---|
Title | Identification of novel piRNAs in bladder cancer | ||
Authors | Chu H, Hui G, Yuan L, Shi D, Wang Y, Du M, Zhong D, Ma L, Tong N, Qin C, Yin C, Zhang Z, Wang M. |