Loading...
| piRBase Id | piR-hsa-28033 | Accession | DQ597803 |
|---|---|---|---|
| Organism | Human | Number of methods | 1 |
| Sequence | GGATACGTGCAAGGTCGCTGAGGCAGTGC | Number of papers | 1 |
| Length | 29 | Golden piRNA | - |
| Aliases | piR-35869; PIR58914; | ||
| No. | Location | Gene | RepeatMaker |
|---|---|---|---|
| Location 1 | 6:33894506-33894535:+ | LINC01016 ENST00000506222; ENSG00000233183 ENST00000666355; LINC01016 ENST00000533304; ENSG00000233183 ENST00000669489; ENSG00000233183 ENST00000660038; ENSG00000233183 ENST00000665879; ENSG00000233183 ENST00000662210; ENSG00000233183 ENST00000661015; ENSG00000233183 ENST00000663283; ENSG00000233183 ENST00000526556; | LTR ERVL LTR75; |
| No record. |
| No record. |
| No record. |
| No record. |
| No record. |
| PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
|---|---|---|---|
| Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
| Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. | ||