Loading...

Detail Information of piRNA: piR-hsa-27493

General Information
piRBase Id piR-hsa-27493 Accession DQ597218
Organism Human Number of methods 2
Sequence GCATTGGTGGTTCAGTGGTAGAATTCTCAC Number of papers 7
Length 30 Golden piRNA -
Aliases piR-35284; PIR58329;
Datasets
Dataset Accession Reads PubMed Method Tissue
1 N/A N/A 16751776 small RNA testis
167 GSM1584521 21 25818294 small RNA adult ovary
168 GSM1584522 139 25818294 small RNA adult ovary
169 GSM1584523 57 25818294 oxidized small RNA adult ovary
170 GSM1584524 49 25818294 oxidized small RNA adult ovary
171 GSM1584525 17 25818294 small RNA ovary from 1st trimester embryos
172 GSM1584526 7 25818294 small RNA ovary from 1st trimester embryos
173 GSM1584527 6 25818294 oxidized small RNA ovary from 1st trimester embryos
175 GSM1584529 93 25818294 small RNA ovary from 2nd trimester embryos
176 GSM1584530 577 25818294 small RNA ovary from 2nd trimester embryos
177 GSM1584531 28 25818294 oxidized small RNA ovary from 2nd trimester embryos
178 GSM1584532 1 25818294 oxidized small RNA ovary from 2nd trimester embryos
289 GSM1386593 4182 26095918 samll RNA Lung(cell line: HBE2; cell type: Immortalized bronchial epithelial)
290 GSM1386594 2098 26095918 samll RNA Lung(cell line: HBE3; cell type: Immortalized bronchial epithelial)
291 GSM1386595 6964 26095918 samll RNA Lung(cell line: HBE4; cell type: Immortalized bronchial epithelial)
292 GSM1386596 9325 26095918 samll RNA Lung(cell line: H522; cell type: Adenocarcinoma (NSCLC))
293 GSM1386597 798 26095918 samll RNA Lung(cell line: H1437; cell type: Adenocarcinoma (NSCLC))
294 GSM1386598 801 26095918 samll RNA Lung(cell line: H1792; cell type: Adenocarcinoma (NSCLC))
295 GSM1386599 909 26095918 samll RNA Lung(cell line: H1944; cell type: Adenocarcinoma (NSCLC))
296 GSM1386600 2030 26095918 samll RNA Lung(cell line: H157; cell type: Squamous (NSCLC))
297 GSM1386601 9845 26095918 samll RNA Lung(cell line: H226; cell type: Squamous (NSCLC))
298 GSM1386602 1643 26095918 samll RNA Lung(cell line: H596; cell type: Squamous (NSCLC))
299 GSM1386603 6712 26095918 samll RNA Lung(cell line: SKMES1; cell type: Squamous (NSCLC))
300 GSM2222674 2634 29516567 small RNA neuroblastoma cell lines (IMR-32)
301 GSM2222675 16417 29516567 small RNA neuroblastoma cell lines (SH-SY-5Y)
302 GSM4585035 4 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
304 GSM4585037 22 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
306 GSM4585039 9 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
308 GSM4585041 130 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
309 GSM4585042 18 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
310 GSM4585043 52 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
311 GSM4585044 46 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
312 GSM4585045 17 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
314 GSM4585047 13 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioma, Grade II-III astrocytoma)
315 GSM4585048 27 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioma, Grade II-III astrocytoma)
316 GSM4585049 25 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioma, Grade II-III astrocytoma)
317 GSM4585050 36 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioma, Grade II-III astrocytoma)
318 GSM4585051 16 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioma, Grade II-III astrocytoma)
320 GSM4020157 1050 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Monolayer culture control
321 GSM4020158 1317 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Monolayer culture control
322 GSM4020159 2085 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Monolayer culture control
323 GSM4020160 1482 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Monolayer culture control
324 GSM4020161 1345 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Femal; Monolayer culture contro
325 GSM4020162 1486 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Monolayer culture contr
326 GSM4020163 2248 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Osteogenic differentiatio
327 GSM4020164 1567 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Osteogenic differentiatio
328 GSM4020165 2623 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Osteogenic differentiatio
329 GSM4020166 2127 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Osteogenic differentiatio
330 GSM4020167 2279 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Osteogenic differentiat
331 GSM4020168 2234 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Osteogenic differentiat
332 GSM4020169 2997 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Pellet culture control (d
333 GSM4020170 8121 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Pellet culture control (d
334 GSM4020171 2832 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Pellet culture control (d
335 GSM4020172 3319 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Pellet culture control (d
336 GSM4020173 2790 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Pellet culture control
337 GSM4020174 2955 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Pellet culture control
338 GSM4020175 4476 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Chondrogenic differentiat
339 GSM4020176 7351 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Chondrogenic differentiat
340 GSM4020177 1493 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Chondrogenic differentiat
341 GSM4020178 2690 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Chondrogenic differentiat
342 GSM4020179 1177 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Chondrogenic differenti
343 GSM4020180 1201 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Chondrogenic differenti
430 GSM2067753 358 27068805 small RNA Seminal plasma(fertile healthy)
431 GSM2067754 60 27068805 small RNA Seminal plasma(asthenozoospermia)
432 GSM2067755 156 27068805 small RNA Seminal plasma(azoospermia)
Location in GRCh38
1 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 1:229537856-229537886:+ ABCB10 ENST00000344517; tRNA tRNA tRNA-Gly-GGY;
piRNA Expression
Sample CPM
GSM1584521 18.873
GSM1584522 95.9537
GSM1584523 54.252
GSM1584524 42.7289
GSM1584525 10.7227
GSM1584526 4.5322
Sample CPM
GSM1584527 8.6302
GSM1584528 0
GSM1584529 41.3609
GSM1584530 283.2345
GSM1584531 3.4383
GSM1584532 1.2545
The Expression of piRNA: piR-hsa-27493
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
Id in article Disease Subtype Expression Function PubMed
piR-19825 breast cancer up-regulated FC 6.52 23229900
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 25818294 Journal Cell Rep. 2015 Mar 31;10(12):2069-82.
Title Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.
PubMed 26095918 Journal Nat Commun. 2015 Jun 22;6:7316. doi: 10.1038/ncomms8316.
Title A piRNA-like small RNA interacts with and modulates p-ERM proteins in human somatic cells.
Authors Mei Y, Wang Y, Kumari P, Shetty AC, Clark D, Gable T, MacKerell AD, Ma MZ, Weber DJ, Yang AJ, Edelman MJ, Mao L.
PubMed 29516567 Journal Genes Chromosomes Cancer. 2018 Jul;57(7):339-349. doi: 10.1002/gcc.22535.
Title Investigating piwi-interacting RNA regulome in human neuroblastoma.
Authors Roy J, Mallick B.
PubMed 32668808 Journal Int J Mol Sci. 2020 Jul 13;21(14):4954. doi: 10.3390/ijms21144954.
Title Deep Sequencing of Small RNAs from Neurosurgical Extracellular Vesicles Substantiates miR-486-3p as a Circulating Biomarker that Distinguishes Glioblastoma from Lower-Grade Astrocytoma Patients.
Authors Hallal S, Ebrahim Khani S, Wei H, Lee MYT, Sim HW, Sy J, Shivalingam B, Buckland ME, Alexander-Kaufman KL.
PubMed 32050423 Journal Cells. 2020 Feb 9;9(2):398. doi: 10.3390/cells9020398.
Title Differential Regulation of circRNA, miRNA, and piRNA during Early Osteogenic and Chondrogenic Differentiation of Human Mesenchymal Stromal Cells.
Authors Della Bella E, Menzel U, Basoli V, Tourbier C, Alini M, Stoddart MJ.
PubMed 27068805 Journal Sci Rep. 2016 Apr 12;6:24229. doi: 10.1038/srep24229.
Title Systematic characterization of seminal plasma piRNAs as molecular biomarkers for male infertility.
Authors Hong Y, Wang C, Fu Z, Liang H, Zhang S, Lu M, Sun W, Ye C, Zhang CY, Zen K, Shi L, Zhang C, Chen X.
PubMed 23229900 Journal Clin Transl Oncol. 2013 Jul;15(7):563-8. doi: 10.1007/s12094-012-0966-0. Epub 2012 Nov 15.
Title Altered expression of piRNAs and their relation with clinicopathologic features of breast cancer.
Authors Huang G, Hu H, Xue X, Shen S, Gao E, Guo G, Shen X, Zhang X.