Loading...

Detail Information of piRNA: piR-hsa-27491

General Information
piRBase Id piR-hsa-27491 Accession DQ597216
Organism Human Number of methods 2
Sequence GCATTGGTGGTATAGTGGTGAGCATA Number of papers 5
Length 26 Golden piRNA Y
Aliases piR-35282; PIR58327;
Datasets
Dataset Accession Reads PubMed Method Tissue
1 N/A N/A 16751776 small RNA testis
167 GSM1584521 2 25818294 small RNA adult ovary
169 GSM1584523 7 25818294 oxidized small RNA adult ovary
170 GSM1584524 6 25818294 oxidized small RNA adult ovary
173 GSM1584527 1 25818294 oxidized small RNA ovary from 1st trimester embryos
175 GSM1584529 1 25818294 small RNA ovary from 2nd trimester embryos
177 GSM1584531 2 25818294 oxidized small RNA ovary from 2nd trimester embryos
178 GSM1584532 1 25818294 oxidized small RNA ovary from 2nd trimester embryos
289 GSM1386593 2 26095918 samll RNA Lung(cell line: HBE2; cell type: Immortalized bronchial epithelial)
291 GSM1386595 3 26095918 samll RNA Lung(cell line: HBE4; cell type: Immortalized bronchial epithelial)
292 GSM1386596 6 26095918 samll RNA Lung(cell line: H522; cell type: Adenocarcinoma (NSCLC))
297 GSM1386601 10 26095918 samll RNA Lung(cell line: H226; cell type: Squamous (NSCLC))
298 GSM1386602 1 26095918 samll RNA Lung(cell line: H596; cell type: Squamous (NSCLC))
299 GSM1386603 2 26095918 samll RNA Lung(cell line: SKMES1; cell type: Squamous (NSCLC))
300 GSM2222674 258 29516567 small RNA neuroblastoma cell lines (IMR-32)
301 GSM2222675 1621 29516567 small RNA neuroblastoma cell lines (SH-SY-5Y)
430 GSM2067753 6 27068805 small RNA Seminal plasma(fertile healthy)
432 GSM2067755 3 27068805 small RNA Seminal plasma(azoospermia)
Location in GRCh38
5 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 11:11510563-11510589:+ GALNT18 ENST00000227756; GALNT18 ENST00000526064; tRNA tRNA tRNA-Gly-GGA;
Location 2 13:89034845-89034871:- LTR ERVL-MaLR MSTA-int;
Location 3 14:76582240-76582266:- ENSG00000259124 ENST00000554926; tRNA tRNA tRNA-Gly-GGA;
Location 4 3:119772624-119772650:+ ENSG00000285585 ENST00000648112; LINE L1 L1M6; tRNA tRNA tRNA-Gly-GGA;
Location 5 6:166883938-166883964:- RPS6KA2 ENST00000512860; ENSG00000249141 ENST00000507747; tRNA tRNA tRNA-Gly-GGA;
piRNA Expression
Sample CPM
GSM1584521 1.7974
GSM1584522 0
GSM1584523 6.6625
GSM1584524 5.2321
GSM1584525 0
GSM1584526 0
Sample CPM
GSM1584527 1.4384
GSM1584528 0
GSM1584529 0.4447
GSM1584530 0
GSM1584531 0.2456
GSM1584532 1.2545
The Expression of piRNA: piR-hsa-27491
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 25818294 Journal Cell Rep. 2015 Mar 31;10(12):2069-82.
Title Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.
PubMed 26095918 Journal Nat Commun. 2015 Jun 22;6:7316. doi: 10.1038/ncomms8316.
Title A piRNA-like small RNA interacts with and modulates p-ERM proteins in human somatic cells.
Authors Mei Y, Wang Y, Kumari P, Shetty AC, Clark D, Gable T, MacKerell AD, Ma MZ, Weber DJ, Yang AJ, Edelman MJ, Mao L.
PubMed 29516567 Journal Genes Chromosomes Cancer. 2018 Jul;57(7):339-349. doi: 10.1002/gcc.22535.
Title Investigating piwi-interacting RNA regulome in human neuroblastoma.
Authors Roy J, Mallick B.
PubMed 27068805 Journal Sci Rep. 2016 Apr 12;6:24229. doi: 10.1038/srep24229.
Title Systematic characterization of seminal plasma piRNAs as molecular biomarkers for male infertility.
Authors Hong Y, Wang C, Fu Z, Liang H, Zhang S, Lu M, Sun W, Ye C, Zhang CY, Zen K, Shi L, Zhang C, Chen X.