Loading...
| piRBase Id | piR-hsa-27491 | Accession | DQ597216 |
|---|---|---|---|
| Organism | Human | Number of methods | 2 |
| Sequence | GCATTGGTGGTATAGTGGTGAGCATA | Number of papers | 5 |
| Length | 26 | Golden piRNA | Y |
| Aliases | piR-35282; PIR58327; | ||
| Dataset | Accession | Reads | PubMed | Method | Tissue |
|---|---|---|---|---|---|
| 1 | N/A | N/A | 16751776 | small RNA | testis |
| 167 | GSM1584521 | 2 | 25818294 | small RNA | adult ovary |
| 169 | GSM1584523 | 7 | 25818294 | oxidized small RNA | adult ovary |
| 170 | GSM1584524 | 6 | 25818294 | oxidized small RNA | adult ovary |
| 173 | GSM1584527 | 1 | 25818294 | oxidized small RNA | ovary from 1st trimester embryos |
| 175 | GSM1584529 | 1 | 25818294 | small RNA | ovary from 2nd trimester embryos |
| 177 | GSM1584531 | 2 | 25818294 | oxidized small RNA | ovary from 2nd trimester embryos |
| 178 | GSM1584532 | 1 | 25818294 | oxidized small RNA | ovary from 2nd trimester embryos |
| 289 | GSM1386593 | 2 | 26095918 | samll RNA | Lung(cell line: HBE2; cell type: Immortalized bronchial epithelial) |
| 291 | GSM1386595 | 3 | 26095918 | samll RNA | Lung(cell line: HBE4; cell type: Immortalized bronchial epithelial) |
| 292 | GSM1386596 | 6 | 26095918 | samll RNA | Lung(cell line: H522; cell type: Adenocarcinoma (NSCLC)) |
| 297 | GSM1386601 | 10 | 26095918 | samll RNA | Lung(cell line: H226; cell type: Squamous (NSCLC)) |
| 298 | GSM1386602 | 1 | 26095918 | samll RNA | Lung(cell line: H596; cell type: Squamous (NSCLC)) |
| 299 | GSM1386603 | 2 | 26095918 | samll RNA | Lung(cell line: SKMES1; cell type: Squamous (NSCLC)) |
| 300 | GSM2222674 | 258 | 29516567 | small RNA | neuroblastoma cell lines (IMR-32) |
| 301 | GSM2222675 | 1621 | 29516567 | small RNA | neuroblastoma cell lines (SH-SY-5Y) |
| 430 | GSM2067753 | 6 | 27068805 | small RNA | Seminal plasma(fertile healthy) |
| 432 | GSM2067755 | 3 | 27068805 | small RNA | Seminal plasma(azoospermia) |
| No. | Location | Gene | RepeatMaker |
|---|---|---|---|
| Location 1 | 11:11510563-11510589:+ | GALNT18 ENST00000227756; GALNT18 ENST00000526064; | tRNA tRNA tRNA-Gly-GGA; |
| Location 2 | 13:89034845-89034871:- | LTR ERVL-MaLR MSTA-int; | |
| Location 3 | 14:76582240-76582266:- | ENSG00000259124 ENST00000554926; | tRNA tRNA tRNA-Gly-GGA; |
| Location 4 | 3:119772624-119772650:+ | ENSG00000285585 ENST00000648112; | LINE L1 L1M6; tRNA tRNA tRNA-Gly-GGA; |
| Location 5 | 6:166883938-166883964:- | RPS6KA2 ENST00000512860; ENSG00000249141 ENST00000507747; | tRNA tRNA tRNA-Gly-GGA; |
| Sample | CPM |
|---|---|
| GSM1584521 | 1.7974 |
| GSM1584522 | 0 |
| GSM1584523 | 6.6625 |
| GSM1584524 | 5.2321 |
| GSM1584525 | 0 |
| GSM1584526 | 0 |
| Sample | CPM |
|---|---|
| GSM1584527 | 1.4384 |
| GSM1584528 | 0 |
| GSM1584529 | 0.4447 |
| GSM1584530 | 0 |
| GSM1584531 | 0.2456 |
| GSM1584532 | 1.2545 |
| No record. |
| No record. |
| No record. |
| No record. |
| PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
|---|---|---|---|
| Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
| Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. | ||
| PubMed | 25818294 | Journal | Cell Rep. 2015 Mar 31;10(12):2069-82. |
|---|---|---|---|
| Title | Piwi proteins and piRNAs in mammalian oocytes and early embryos. | ||
| Authors | Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF. | ||
| PubMed | 26095918 | Journal | Nat Commun. 2015 Jun 22;6:7316. doi: 10.1038/ncomms8316. |
|---|---|---|---|
| Title | A piRNA-like small RNA interacts with and modulates p-ERM proteins in human somatic cells. | ||
| Authors | Mei Y, Wang Y, Kumari P, Shetty AC, Clark D, Gable T, MacKerell AD, Ma MZ, Weber DJ, Yang AJ, Edelman MJ, Mao L. | ||
| PubMed | 29516567 | Journal | Genes Chromosomes Cancer. 2018 Jul;57(7):339-349. doi: 10.1002/gcc.22535. |
|---|---|---|---|
| Title | Investigating piwi-interacting RNA regulome in human neuroblastoma. | ||
| Authors | Roy J, Mallick B. | ||
| PubMed | 27068805 | Journal | Sci Rep. 2016 Apr 12;6:24229. doi: 10.1038/srep24229. |
|---|---|---|---|
| Title | Systematic characterization of seminal plasma piRNAs as molecular biomarkers for male infertility. | ||
| Authors | Hong Y, Wang C, Fu Z, Liang H, Zhang S, Lu M, Sun W, Ye C, Zhang CY, Zen K, Shi L, Zhang C, Chen X. | ||