Loading...
piRBase Id | piR-hsa-271 | Accession | DQ569947 |
---|---|---|---|
Organism | Human | Number of methods | 1 |
Sequence | AAAGATGGCAGATACAGCACCAGGGC | Number of papers | 3 |
Length | 26 | Golden piRNA | - |
Aliases | piR-30059; PIR31058; |
Dataset | Accession | Reads | PubMed | Method | Tissue |
---|---|---|---|---|---|
1 | N/A | N/A | 16751776 | small RNA | testis |
301 | GSM2222675 | N/A | 29516567 | small RNA | neuroblastoma cell lines (SH-SY-5Y) |
430 | GSM2067753 | 4 | 27068805 | small RNA | Seminal plasma(fertile healthy) |
No. | Location | Gene | RepeatMaker |
---|---|---|---|
Location 1 | 22:18848376-18848402:+ | ENSG00000161103 ENST00000419447; | |
Location 2 | 22:21126165-21126191:- | POM121L7P ENST00000329949; | |
Location 3 | 22:21284325-21284351:+ | ||
Location 4 | KI270731.1:11103-11129:- | ENSG00000278633 ENST00000619792; | |
Location 5 | KI270734.1:74282-74308:+ | ENSG00000276017 ENST00000617983; |
No record. |
No record. |
No record. |
No record. |
No record. |
PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
---|---|---|---|
Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. |
PubMed | 29516567 | Journal | Genes Chromosomes Cancer. 2018 Jul;57(7):339-349. doi: 10.1002/gcc.22535. |
---|---|---|---|
Title | Investigating piwi-interacting RNA regulome in human neuroblastoma. | ||
Authors | Roy J, Mallick B. |
PubMed | 27068805 | Journal | Sci Rep. 2016 Apr 12;6:24229. doi: 10.1038/srep24229. |
---|---|---|---|
Title | Systematic characterization of seminal plasma piRNAs as molecular biomarkers for male infertility. | ||
Authors | Hong Y, Wang C, Fu Z, Liang H, Zhang S, Lu M, Sun W, Ye C, Zhang CY, Zen K, Shi L, Zhang C, Chen X. |