Loading...

Detail Information of piRNA: piR-hsa-271

General Information
piRBase Id piR-hsa-271 Accession DQ569947
Organism Human Number of methods 1
Sequence AAAGATGGCAGATACAGCACCAGGGC Number of papers 3
Length 26 Golden piRNA -
Aliases piR-30059; PIR31058;
Datasets
Dataset Accession Reads PubMed Method Tissue
1 N/A N/A 16751776 small RNA testis
301 GSM2222675 N/A 29516567 small RNA neuroblastoma cell lines (SH-SY-5Y)
430 GSM2067753 4 27068805 small RNA Seminal plasma(fertile healthy)
Location in GRCh38
5 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 22:18848376-18848402:+ ENSG00000161103 ENST00000419447;
Location 2 22:21126165-21126191:- POM121L7P ENST00000329949;
Location 3 22:21284325-21284351:+
Location 4 KI270731.1:11103-11129:- ENSG00000278633 ENST00000619792;
Location 5 KI270734.1:74282-74308:+ ENSG00000276017 ENST00000617983;
piRNA Expression
No record.
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 29516567 Journal Genes Chromosomes Cancer. 2018 Jul;57(7):339-349. doi: 10.1002/gcc.22535.
Title Investigating piwi-interacting RNA regulome in human neuroblastoma.
Authors Roy J, Mallick B.
PubMed 27068805 Journal Sci Rep. 2016 Apr 12;6:24229. doi: 10.1038/srep24229.
Title Systematic characterization of seminal plasma piRNAs as molecular biomarkers for male infertility.
Authors Hong Y, Wang C, Fu Z, Liang H, Zhang S, Lu M, Sun W, Ye C, Zhang CY, Zen K, Shi L, Zhang C, Chen X.