Loading...

Detail Information of piRNA: piR-hsa-26634

General Information
piRBase Id piR-hsa-26634 Accession DQ596418
Organism Human Number of methods 1
Sequence GACTCAGCGATTCTGGCAAGCGGTAC Number of papers 2
Length 26 Golden piRNA -
Aliases piR-34484; PIR57529;
Datasets
Dataset Accession Reads PubMed Method Tissue
1 N/A N/A 16751776 small RNA testis
430 GSM2067753 2 27068805 small RNA Seminal plasma(fertile healthy)
Location in GRCh38
1 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 2:131407991-131408017:+ LINC01120 ENST00000437751; LINC01120 ENST00000663072; LINC01120 ENST00000668661; LINC01120 ENST00000669881; LINC01120 ENST00000664380; LINC01120 ENST00000671275; LINC01120 ENST00000671078; LINC01120 ENST00000662267; LINC01120 ENST00000670748; LINC01120 ENST00000666196;
piRNA Expression
No record.
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 27068805 Journal Sci Rep. 2016 Apr 12;6:24229. doi: 10.1038/srep24229.
Title Systematic characterization of seminal plasma piRNAs as molecular biomarkers for male infertility.
Authors Hong Y, Wang C, Fu Z, Liang H, Zhang S, Lu M, Sun W, Ye C, Zhang CY, Zen K, Shi L, Zhang C, Chen X.