Loading...
| piRBase Id | piR-hsa-26501 | Accession | DQ596285 |
|---|---|---|---|
| Organism | Human | Number of methods | 1 |
| Sequence | GACATGGGGAGCTAAGTTGGCCATTGCTT | Number of papers | 1 |
| Length | 29 | Golden piRNA | - |
| Aliases | piR-34351; PIR57396; | ||
| No. | Location | Gene | RepeatMaker |
|---|---|---|---|
| Location 1 | 1:1665658-1665687:- | SLC35E2B ENST00000614300; SLC35E2B ENST00000617444; SLC35E2B ENST00000611123; SLC35E2B ENST00000480991; |
| No record. |
| No record. |
| No record. |
| No record. |
| No record. |
| PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
|---|---|---|---|
| Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
| Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. | ||