Loading...
piRBase Id | piR-hsa-255 | Accession | DQ569931 |
---|---|---|---|
Organism | Human | Number of methods | 1 |
Sequence | AAACTGCGTACAAGAATTCCTCAGCCACTGC | Number of papers | 2 |
Length | 31 | Golden piRNA | - |
Aliases | piR-30043; PIR31042; |
Dataset | Accession | Reads | PubMed | Method | Tissue |
---|---|---|---|---|---|
1 | N/A | N/A | 16751776 | small RNA | testis |
301 | GSM2222675 | N/A | 29516567 | small RNA | neuroblastoma cell lines (SH-SY-5Y) |
No. | Location | Gene | RepeatMaker |
---|---|---|---|
Location 1 | 19:1273098-1273129:- | CIRBP ENST00000588030; CIRBP ENST00000586472; CIRBP ENST00000588090; CIRBP ENST00000591935; CIRBP ENST00000586548; CIRBP ENST00000585913; CIRBP ENST00000589710; CIRBP ENST00000586773; CIRBP ENST00000587896; CIRBP ENST00000593093; CIRBP ENST00000413636; CIRBP ENST00000590347; CIRBP ENST00000587169; CIRBP ENST00000320936; CIRBP ENST00000586636; CIRBP ENST00000591376; CIRBP ENST00000589235; CIRBP ENST00000585914; CIRBP ENST00000588344; CIRBP ENST00000592234; CIRBP ENST00000444172; CIRBP ENST00000590188; CIRBP ENST00000588917; |
No record. |
No record. |
No record. |
No record. |
No record. |
PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
---|---|---|---|
Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. |
PubMed | 29516567 | Journal | Genes Chromosomes Cancer. 2018 Jul;57(7):339-349. doi: 10.1002/gcc.22535. |
---|---|---|---|
Title | Investigating piwi-interacting RNA regulome in human neuroblastoma. | ||
Authors | Roy J, Mallick B. |