Loading...

Detail Information of piRNA: piR-hsa-255

General Information
piRBase Id piR-hsa-255 Accession DQ569931
Organism Human Number of methods 1
Sequence AAACTGCGTACAAGAATTCCTCAGCCACTGC Number of papers 2
Length 31 Golden piRNA -
Aliases piR-30043; PIR31042;
Datasets
Dataset Accession Reads PubMed Method Tissue
1 N/A N/A 16751776 small RNA testis
301 GSM2222675 N/A 29516567 small RNA neuroblastoma cell lines (SH-SY-5Y)
Location in GRCh38
1 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 19:1273098-1273129:- CIRBP ENST00000588030; CIRBP ENST00000586472; CIRBP ENST00000588090; CIRBP ENST00000591935; CIRBP ENST00000586548; CIRBP ENST00000585913; CIRBP ENST00000589710; CIRBP ENST00000586773; CIRBP ENST00000587896; CIRBP ENST00000593093; CIRBP ENST00000413636; CIRBP ENST00000590347; CIRBP ENST00000587169; CIRBP ENST00000320936; CIRBP ENST00000586636; CIRBP ENST00000591376; CIRBP ENST00000589235; CIRBP ENST00000585914; CIRBP ENST00000588344; CIRBP ENST00000592234; CIRBP ENST00000444172; CIRBP ENST00000590188; CIRBP ENST00000588917;
piRNA Expression
No record.
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 29516567 Journal Genes Chromosomes Cancer. 2018 Jul;57(7):339-349. doi: 10.1002/gcc.22535.
Title Investigating piwi-interacting RNA regulome in human neuroblastoma.
Authors Roy J, Mallick B.