Loading...

Detail Information of piRNA: piR-hsa-2524300

General Information
piRBase Id piR-hsa-2524300 Accession N/A
Organism Human Number of methods 1
Sequence TAGAGCACATGTTATGGTTATCGA Number of papers 1
Length 24 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
172 GSM1584526 1 25818294 small RNA ovary from 1st trimester embryos
Location in GRCh38
1 best hit(s) with 1 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 1:16905206-16905230:+ CROCC ENST00000466256;
piRNA Expression
The Expression of piRNA: piR-hsa-2524300
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 25818294 Journal Cell Rep. 2015 Mar 31;10(12):2069-82.
Title Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.