Loading...

Detail Information of piRNA: piR-hsa-24360

General Information
piRBase Id piR-hsa-24360 Accession DQ594126
Organism Human Number of methods 2
Sequence TTCACTGATGAGAGCATTGTTCTGAGC Number of papers 5
Length 27 Golden piRNA Y
Aliases piR-60238; PIR55237;
Datasets
Dataset Accession Reads PubMed Method Tissue
1 N/A N/A 16751776 small RNA testis
167 GSM1584521 2454 25818294 small RNA adult ovary
168 GSM1584522 3048 25818294 small RNA adult ovary
169 GSM1584523 87 25818294 oxidized small RNA adult ovary
170 GSM1584524 55 25818294 oxidized small RNA adult ovary
171 GSM1584525 128 25818294 small RNA ovary from 1st trimester embryos
172 GSM1584526 301 25818294 small RNA ovary from 1st trimester embryos
173 GSM1584527 12 25818294 oxidized small RNA ovary from 1st trimester embryos
174 GSM1584528 1 25818294 oxidized small RNA ovary from 1st trimester embryos
175 GSM1584529 398 25818294 small RNA ovary from 2nd trimester embryos
176 GSM1584530 305 25818294 small RNA ovary from 2nd trimester embryos
177 GSM1584531 5 25818294 oxidized small RNA ovary from 2nd trimester embryos
178 GSM1584532 3 25818294 oxidized small RNA ovary from 2nd trimester embryos
300 GSM2222674 174 29516567 small RNA neuroblastoma cell lines (IMR-32)
301 GSM2222675 4461 29516567 small RNA neuroblastoma cell lines (SH-SY-5Y)
302 GSM4585035 37 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
320 GSM4020157 68 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Monolayer culture control
321 GSM4020158 79 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Monolayer culture control
322 GSM4020159 99 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Monolayer culture control
323 GSM4020160 76 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Monolayer culture control
324 GSM4020161 27 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Femal; Monolayer culture contro
325 GSM4020162 31 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Monolayer culture contr
326 GSM4020163 61 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Osteogenic differentiatio
327 GSM4020164 49 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Osteogenic differentiatio
328 GSM4020165 48 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Osteogenic differentiatio
329 GSM4020166 37 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Osteogenic differentiatio
330 GSM4020167 15 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Osteogenic differentiat
331 GSM4020168 14 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Osteogenic differentiat
332 GSM4020169 67 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Pellet culture control (d
333 GSM4020170 111 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Pellet culture control (d
334 GSM4020171 99 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Pellet culture control (d
335 GSM4020172 74 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Pellet culture control (d
336 GSM4020173 34 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Pellet culture control
337 GSM4020174 33 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Pellet culture control
338 GSM4020175 69 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Chondrogenic differentiat
339 GSM4020176 175 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Chondrogenic differentiat
340 GSM4020177 60 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Chondrogenic differentiat
341 GSM4020178 84 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Chondrogenic differentiat
342 GSM4020179 21 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Chondrogenic differenti
343 GSM4020180 17 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Chondrogenic differenti
Location in GRCh38
1 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 1:30968167-30968194:- PUM1 ENST00000426105; PUM1 ENST00000373747; PUM1 ENST00000257075; PUM1 ENST00000424085; PUM1 ENST00000525843; PUM1 ENST00000440538; PUM1 ENST00000498419; PUM1 ENST00000373741; PUM1 ENST00000373742; PUM1 ENST00000471894; PUM1 ENST00000490546; PUM1 ENST00000532678;
piRNA Expression
Sample CPM
GSM1584521 2205.4502
GSM1584522 2104.0787
GSM1584523 82.8056
GSM1584524 47.961
GSM1584525 80.7357
GSM1584526 194.8855
Sample CPM
GSM1584527 17.2605
GSM1584528 106.4623
GSM1584529 177.0069
GSM1584530 149.7167
GSM1584531 0.614
GSM1584532 3.7635
The Expression of piRNA: piR-hsa-24360
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
Id in article Disease Subtype Expression Function PubMed
piR-17458 Breast cancer down-regulated FC 2.04 23229900
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 25818294 Journal Cell Rep. 2015 Mar 31;10(12):2069-82.
Title Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.
PubMed 29516567 Journal Genes Chromosomes Cancer. 2018 Jul;57(7):339-349. doi: 10.1002/gcc.22535.
Title Investigating piwi-interacting RNA regulome in human neuroblastoma.
Authors Roy J, Mallick B.
PubMed 32668808 Journal Int J Mol Sci. 2020 Jul 13;21(14):4954. doi: 10.3390/ijms21144954.
Title Deep Sequencing of Small RNAs from Neurosurgical Extracellular Vesicles Substantiates miR-486-3p as a Circulating Biomarker that Distinguishes Glioblastoma from Lower-Grade Astrocytoma Patients.
Authors Hallal S, Ebrahim Khani S, Wei H, Lee MYT, Sim HW, Sy J, Shivalingam B, Buckland ME, Alexander-Kaufman KL.
PubMed 32050423 Journal Cells. 2020 Feb 9;9(2):398. doi: 10.3390/cells9020398.
Title Differential Regulation of circRNA, miRNA, and piRNA during Early Osteogenic and Chondrogenic Differentiation of Human Mesenchymal Stromal Cells.
Authors Della Bella E, Menzel U, Basoli V, Tourbier C, Alini M, Stoddart MJ.
PubMed 23229900 Journal Clin Transl Oncol. 2013 Jul;15(7):563-8. doi: 10.1007/s12094-012-0966-0. Epub 2012 Nov 15.
Title Altered expression of piRNAs and their relation with clinicopathologic features of breast cancer.
Authors Huang G, Hu H, Xue X, Shen S, Gao E, Guo G, Shen X, Zhang X.