Loading...

Detail Information of piRNA: piR-hsa-2322

General Information
piRBase Id piR-hsa-2322 Accession DQ572042
Organism Human Number of methods 2
Sequence TATACCGAGACATTCCATTGCCCAGGGAC Number of papers 2
Length 29 Golden piRNA Y
Aliases piR-40154; PIR33153;
Datasets
Dataset Accession Reads PubMed Method Tissue
1 N/A N/A 16751776 small RNA testis
169 GSM1584523 1 25818294 oxidized small RNA adult ovary
175 GSM1584529 15 25818294 small RNA ovary from 2nd trimester embryos
176 GSM1584530 8 25818294 small RNA ovary from 2nd trimester embryos
177 GSM1584531 116 25818294 oxidized small RNA ovary from 2nd trimester embryos
178 GSM1584532 10 25818294 oxidized small RNA ovary from 2nd trimester embryos
Location in GRCh38
233 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 17:17611361-17611390:+ LTR ERVK LTR5_Hs;
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
Sample CPM
GSM1584521 0
GSM1584522 0
GSM1584523 0.9518
GSM1584524 0
GSM1584525 0
GSM1584526 0
Sample CPM
GSM1584527 0
GSM1584528 0
GSM1584529 6.6711
GSM1584530 3.927
GSM1584531 14.2444
GSM1584532 12.545
The Expression of piRNA: piR-hsa-2322
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
Id in article Disease Subtype Expression Function PubMed
DQ572042 Bladder cancer down-regulated FC 7.2 25305452
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 25818294 Journal Cell Rep. 2015 Mar 31;10(12):2069-82.
Title Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.
PubMed 25305452 Journal Cancer Lett. 2015 Jan 28;356(2 Pt B):561-7. doi: 10.1016/j.canlet.2014.10.004. Epub 2014 Oct 8.
Title Identification of novel piRNAs in bladder cancer
Authors Chu H, Hui G, Yuan L, Shi D, Wang Y, Du M, Zhong D, Ma L, Tong N, Qin C, Yin C, Zhang Z, Wang M.