Loading...
| piRBase Id | piR-hsa-225 | Accession | DQ571067 |
|---|---|---|---|
| Organism | Human | Number of methods | 1 |
| Sequence | AGCTGGAGTGCAGTGGTGCGATCACGGC | Number of papers | 4 |
| Length | 28 | Golden piRNA | - |
| Aliases | piR-31179; PIR32178; | ||
| Dataset | Accession | Reads | PubMed | Method | Tissue |
|---|---|---|---|---|---|
| 1 | N/A | N/A | 16751776 | small RNA | testis |
| 300 | GSM2222674 | 42 | 29516567 | small RNA | neuroblastoma cell lines (IMR-32) |
| 301 | GSM2222675 | 112 | 29516567 | small RNA | neuroblastoma cell lines (SH-SY-5Y) |
| 302 | GSM4585035 | 33 | 32668808 | small RNA | Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma) |
| 312 | GSM4585045 | 58 | 32668808 | small RNA | Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma) |
| 321 | GSM4020158 | 1 | 32050423 | small RNA | mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Monolayer culture control |
| 322 | GSM4020159 | 1 | 32050423 | small RNA | mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Monolayer culture control |
| 323 | GSM4020160 | 1 | 32050423 | small RNA | mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Monolayer culture control |
| 331 | GSM4020168 | 1 | 32050423 | small RNA | mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Osteogenic differentiat |
| 333 | GSM4020170 | 1 | 32050423 | small RNA | mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Pellet culture control (d |
| 334 | GSM4020171 | 1 | 32050423 | small RNA | mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Pellet culture control (d |
| 335 | GSM4020172 | 1 | 32050423 | small RNA | mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Pellet culture control (d |
| 337 | GSM4020174 | 6 | 32050423 | small RNA | mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Pellet culture control |
| 338 | GSM4020175 | 1 | 32050423 | small RNA | mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Chondrogenic differentiat |
| 339 | GSM4020176 | 1 | 32050423 | small RNA | mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Chondrogenic differentiat |
| 341 | GSM4020178 | 1 | 32050423 | small RNA | mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Chondrogenic differentiat |
| 342 | GSM4020179 | 1 | 32050423 | small RNA | mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Chondrogenic differenti |
| 343 | GSM4020180 | 2 | 32050423 | small RNA | mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Chondrogenic differenti |
| No. | Location | Gene | RepeatMaker |
|---|---|---|---|
| Location 1 | 13:105482553-105482581:+ | DAOA-AS1 ENST00000448407; DAOA ENST00000559369; DAOA ENST00000600388; DAOA ENST00000473269; DAOA ENST00000488534; DAOA ENST00000375936; DAOA ENST00000489237; DAOA ENST00000601240; DAOA ENST00000595812; DAOA ENST00000329625; DAOA ENST00000618629; DAOA ENST00000471432; | SINE Alu AluSg; |
| Location 2 | 16:4311001-4311029:- | SINE Alu AluJb; | |
| Location 3 | 18:7792708-7792736:+ | PTPRM ENST00000332175; PTPRM ENST00000580170; PTPRM ENST00000400053; PTPRM ENST00000400060; | SINE Alu AluJb; |
| Location 4 | 2:111220780-111220808:- | MIR4435-2HG ENST00000645030; MIR4435-2HG ENST00000642191; MIR4435-2HG ENST00000673798; MIR4435-2HG ENST00000645051; MIR4435-2HG ENST00000673649; MIR4435-2HG ENST00000673962; MIR4435-2HG ENST00000674132; MIR4435-2HG ENST00000669658; MIR4435-2HG ENST00000669917; MIR4435-2HG ENST00000661559; MIR4435-2HG ENST00000653687; MIR4435-2HG ENST00000667670; MIR4435-2HG ENST00000609220; MIR4435-2HG ENST00000656760; MIR4435-2HG ENST00000609902; MIR4435-2HG ENST00000674070; MIR4435-2HG ENST00000666683; MIR4435-2HG ENST00000662335; MIR4435-2HG ENST00000664422; MIR4435-2HG ENST00000673775; MIR4435-2HG ENST00000662889; MIR4435-2HG ENST00000665096; MIR4435-2HG ENST00000674092; MIR4435-2HG ENST00000673958; MIR4435-2HG ENST00000673770; MIR4435-2HG ENST00000673961; MIR4435-2HG ENST00000658936; MIR4435-2HG ENST00000662635; MIR4435-2HG ENST00000666204; MIR4435-2HG ENST00000659458; MIR4435-2HG ENST00000664443; MIR4435-2HG ENST00000670295; MIR4435-2HG ENST00000661655; MIR4435-2HG ENST00000666390; MIR4435-2HG ENST00000659079; MIR4435-2HG ENST00000660442; MIR4435-2HG ENST00000664009; MIR4435-2HG ENST00000439362; MIR4435-2HG ENST00000664999; MIR4435-2HG ENST00000654473; MIR4435-2HG ENST00000673728; MIR4435-2HG ENST00000659791; MIR4435-2HG ENST00000666144; MIR4435-2HG ENST00000659933; MIR4435-2HG ENST00000670715; MIR4435-2HG ENST00000656303; MIR4435-2HG ENST00000666367; MIR4435-2HG ENST00000666652; MIR4435-2HG ENST00000669050; MIR4435-2HG ENST00000667218; MIR4435-2HG ENST00000656067; MIR4435-2HG ENST00000653568; MIR4435-2HG ENST00000643013; MIR4435-2HG ENST00000673866; MIR4435-2HG ENST00000673700; MIR4435-2HG ENST00000443467; MIR4435-2HG ENST00000451884; MIR4435-2HG ENST00000669875; MIR4435-2HG ENST00000659806; | SINE Alu AluSq2; |
| Location 5 | 2:237965909-237965937:+ | SINE Alu AluJb; | |
| Location 6 | 22:26533718-26533746:+ | TPST2 ENST00000338754; TPST2 ENST00000403880; TPST2 ENST00000398110; | SINE Alu AluJb; |
| Location 7 | 22:30408530-30408558:- | RNF215 ENST00000431544; SEC14L2 ENST00000428195; SEC14L2 ENST00000617837; SEC14L2 ENST00000619483; SEC14L2 ENST00000615189; SEC14L2 ENST00000452649; SEC14L2 ENST00000437022; SEC14L2 ENST00000416523; SEC14L2 ENST00000405717; SEC14L2 ENST00000402592; SEC14L2 ENST00000459728; SEC14L2 ENST00000464335; | SINE Alu AluJb; |
| Location 8 | 6:137524038-137524066:+ | SINE Alu AluJb; | |
| Location 9 | 6:155442209-155442237:- | NOX3 ENST00000159060; | SINE Alu AluY; |
| Location 10 | CHR_HSCHR16_3_CTG1:4311001-4311029:- |
| No record. |
| No record. |
| No record. |
| No record. |
| No record. |
| PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
|---|---|---|---|
| Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
| Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. | ||
| PubMed | 29516567 | Journal | Genes Chromosomes Cancer. 2018 Jul;57(7):339-349. doi: 10.1002/gcc.22535. |
|---|---|---|---|
| Title | Investigating piwi-interacting RNA regulome in human neuroblastoma. | ||
| Authors | Roy J, Mallick B. | ||
| PubMed | 32668808 | Journal | Int J Mol Sci. 2020 Jul 13;21(14):4954. doi: 10.3390/ijms21144954. |
|---|---|---|---|
| Title | Deep Sequencing of Small RNAs from Neurosurgical Extracellular Vesicles Substantiates miR-486-3p as a Circulating Biomarker that Distinguishes Glioblastoma from Lower-Grade Astrocytoma Patients. | ||
| Authors | Hallal S, Ebrahim Khani S, Wei H, Lee MYT, Sim HW, Sy J, Shivalingam B, Buckland ME, Alexander-Kaufman KL. | ||
| PubMed | 32050423 | Journal | Cells. 2020 Feb 9;9(2):398. doi: 10.3390/cells9020398. |
|---|---|---|---|
| Title | Differential Regulation of circRNA, miRNA, and piRNA during Early Osteogenic and Chondrogenic Differentiation of Human Mesenchymal Stromal Cells. | ||
| Authors | Della Bella E, Menzel U, Basoli V, Tourbier C, Alini M, Stoddart MJ. | ||