Loading...

Detail Information of piRNA: piR-hsa-225

General Information
piRBase Id piR-hsa-225 Accession DQ571067
Organism Human Number of methods 1
Sequence AGCTGGAGTGCAGTGGTGCGATCACGGC Number of papers 4
Length 28 Golden piRNA -
Aliases piR-31179; PIR32178;
Datasets
Dataset Accession Reads PubMed Method Tissue
1 N/A N/A 16751776 small RNA testis
300 GSM2222674 42 29516567 small RNA neuroblastoma cell lines (IMR-32)
301 GSM2222675 112 29516567 small RNA neuroblastoma cell lines (SH-SY-5Y)
302 GSM4585035 33 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
312 GSM4585045 58 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
321 GSM4020158 1 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Monolayer culture control
322 GSM4020159 1 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Monolayer culture control
323 GSM4020160 1 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Monolayer culture control
331 GSM4020168 1 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Osteogenic differentiat
333 GSM4020170 1 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Pellet culture control (d
334 GSM4020171 1 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Pellet culture control (d
335 GSM4020172 1 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Pellet culture control (d
337 GSM4020174 6 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Pellet culture control
338 GSM4020175 1 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Chondrogenic differentiat
339 GSM4020176 1 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Chondrogenic differentiat
341 GSM4020178 1 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Chondrogenic differentiat
342 GSM4020179 1 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Chondrogenic differenti
343 GSM4020180 2 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Chondrogenic differenti
Location in GRCh38
10 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 13:105482553-105482581:+ DAOA-AS1 ENST00000448407; DAOA ENST00000559369; DAOA ENST00000600388; DAOA ENST00000473269; DAOA ENST00000488534; DAOA ENST00000375936; DAOA ENST00000489237; DAOA ENST00000601240; DAOA ENST00000595812; DAOA ENST00000329625; DAOA ENST00000618629; DAOA ENST00000471432; SINE Alu AluSg;
Location 2 16:4311001-4311029:- SINE Alu AluJb;
Location 3 18:7792708-7792736:+ PTPRM ENST00000332175; PTPRM ENST00000580170; PTPRM ENST00000400053; PTPRM ENST00000400060; SINE Alu AluJb;
Location 4 2:111220780-111220808:- MIR4435-2HG ENST00000645030; MIR4435-2HG ENST00000642191; MIR4435-2HG ENST00000673798; MIR4435-2HG ENST00000645051; MIR4435-2HG ENST00000673649; MIR4435-2HG ENST00000673962; MIR4435-2HG ENST00000674132; MIR4435-2HG ENST00000669658; MIR4435-2HG ENST00000669917; MIR4435-2HG ENST00000661559; MIR4435-2HG ENST00000653687; MIR4435-2HG ENST00000667670; MIR4435-2HG ENST00000609220; MIR4435-2HG ENST00000656760; MIR4435-2HG ENST00000609902; MIR4435-2HG ENST00000674070; MIR4435-2HG ENST00000666683; MIR4435-2HG ENST00000662335; MIR4435-2HG ENST00000664422; MIR4435-2HG ENST00000673775; MIR4435-2HG ENST00000662889; MIR4435-2HG ENST00000665096; MIR4435-2HG ENST00000674092; MIR4435-2HG ENST00000673958; MIR4435-2HG ENST00000673770; MIR4435-2HG ENST00000673961; MIR4435-2HG ENST00000658936; MIR4435-2HG ENST00000662635; MIR4435-2HG ENST00000666204; MIR4435-2HG ENST00000659458; MIR4435-2HG ENST00000664443; MIR4435-2HG ENST00000670295; MIR4435-2HG ENST00000661655; MIR4435-2HG ENST00000666390; MIR4435-2HG ENST00000659079; MIR4435-2HG ENST00000660442; MIR4435-2HG ENST00000664009; MIR4435-2HG ENST00000439362; MIR4435-2HG ENST00000664999; MIR4435-2HG ENST00000654473; MIR4435-2HG ENST00000673728; MIR4435-2HG ENST00000659791; MIR4435-2HG ENST00000666144; MIR4435-2HG ENST00000659933; MIR4435-2HG ENST00000670715; MIR4435-2HG ENST00000656303; MIR4435-2HG ENST00000666367; MIR4435-2HG ENST00000666652; MIR4435-2HG ENST00000669050; MIR4435-2HG ENST00000667218; MIR4435-2HG ENST00000656067; MIR4435-2HG ENST00000653568; MIR4435-2HG ENST00000643013; MIR4435-2HG ENST00000673866; MIR4435-2HG ENST00000673700; MIR4435-2HG ENST00000443467; MIR4435-2HG ENST00000451884; MIR4435-2HG ENST00000669875; MIR4435-2HG ENST00000659806; SINE Alu AluSq2;
Location 5 2:237965909-237965937:+ SINE Alu AluJb;
Location 6 22:26533718-26533746:+ TPST2 ENST00000338754; TPST2 ENST00000403880; TPST2 ENST00000398110; SINE Alu AluJb;
Location 7 22:30408530-30408558:- RNF215 ENST00000431544; SEC14L2 ENST00000428195; SEC14L2 ENST00000617837; SEC14L2 ENST00000619483; SEC14L2 ENST00000615189; SEC14L2 ENST00000452649; SEC14L2 ENST00000437022; SEC14L2 ENST00000416523; SEC14L2 ENST00000405717; SEC14L2 ENST00000402592; SEC14L2 ENST00000459728; SEC14L2 ENST00000464335; SINE Alu AluJb;
Location 8 6:137524038-137524066:+ SINE Alu AluJb;
Location 9 6:155442209-155442237:- NOX3 ENST00000159060; SINE Alu AluY;
Location 10 CHR_HSCHR16_3_CTG1:4311001-4311029:-
piRNA Expression
No record.
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 29516567 Journal Genes Chromosomes Cancer. 2018 Jul;57(7):339-349. doi: 10.1002/gcc.22535.
Title Investigating piwi-interacting RNA regulome in human neuroblastoma.
Authors Roy J, Mallick B.
PubMed 32668808 Journal Int J Mol Sci. 2020 Jul 13;21(14):4954. doi: 10.3390/ijms21144954.
Title Deep Sequencing of Small RNAs from Neurosurgical Extracellular Vesicles Substantiates miR-486-3p as a Circulating Biomarker that Distinguishes Glioblastoma from Lower-Grade Astrocytoma Patients.
Authors Hallal S, Ebrahim Khani S, Wei H, Lee MYT, Sim HW, Sy J, Shivalingam B, Buckland ME, Alexander-Kaufman KL.
PubMed 32050423 Journal Cells. 2020 Feb 9;9(2):398. doi: 10.3390/cells9020398.
Title Differential Regulation of circRNA, miRNA, and piRNA during Early Osteogenic and Chondrogenic Differentiation of Human Mesenchymal Stromal Cells.
Authors Della Bella E, Menzel U, Basoli V, Tourbier C, Alini M, Stoddart MJ.