Loading...

Detail Information of piRNA: piR-hsa-219

General Information
piRBase Id piR-hsa-219 Accession DQ570828
Organism Human Number of methods 2
Sequence AGAGCTGTAACACTCACGGGGAAGGTCTGC Number of papers 3
Length 30 Golden piRNA -
Aliases piR-30940; PIR31939;
Datasets
Dataset Accession Reads PubMed Method Tissue
1 N/A N/A 16751776 small RNA testis
177 GSM1584531 1 25818294 oxidized small RNA ovary from 2nd trimester embryos
300 GSM2222674 10 29516567 small RNA neuroblastoma cell lines (IMR-32)
301 GSM2222675 22 29516567 small RNA neuroblastoma cell lines (SH-SY-5Y)
Location in GRCh38
3 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 2:130992479-130992509:+ ARHGEF4 ENST00000409359; ARHGEF4 ENST00000611048; ARHGEF4 ENST00000428230; ARHGEF4 ENST00000326016; ARHGEF4 ENST00000636987; ARHGEF4 ENST00000438985; ARHGEF4 ENST00000392953; ARHGEF4 ENST00000409303; LTR ERV1 LTR12C;
Location 2 4:38183540-38183570:+ LTR ERV1 LTR12C;
Location 3 X:143228110-143228140:- LTR ERV1 LTR12C;
piRNA Expression
Sample CPM
GSM1584521 0
GSM1584522 0
GSM1584523 0
GSM1584524 0
GSM1584525 0
GSM1584526 0
Sample CPM
GSM1584527 0
GSM1584528 0
GSM1584529 0
GSM1584530 0
GSM1584531 0.1228
GSM1584532 0
The Expression of piRNA: piR-hsa-219
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 25818294 Journal Cell Rep. 2015 Mar 31;10(12):2069-82.
Title Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.
PubMed 29516567 Journal Genes Chromosomes Cancer. 2018 Jul;57(7):339-349. doi: 10.1002/gcc.22535.
Title Investigating piwi-interacting RNA regulome in human neuroblastoma.
Authors Roy J, Mallick B.