Loading...
| piRBase Id | piR-hsa-21478 | Accession | DQ591213 |
|---|---|---|---|
| Organism | Human | Number of methods | 1 |
| Sequence | TGTCTGATTCATCTCTGTGCTCCCAGAAT | Number of papers | 2 |
| Length | 29 | Golden piRNA | - |
| Aliases | piR-58325; PIR52324; | ||
| Dataset | Accession | Reads | PubMed | Method | Tissue |
|---|---|---|---|---|---|
| 1 | N/A | N/A | 16751776 | small RNA | testis |
| 430 | GSM2067753 | 5 | 27068805 | small RNA | Seminal plasma(fertile healthy) |
| No. | Location | Gene | RepeatMaker |
|---|---|---|---|
| Location 1 | 1:24253379-24253408:- | LINE L2 L2c; |
| No record. |
| No record. |
| No record. |
| No record. |
| No record. |
| PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
|---|---|---|---|
| Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
| Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. | ||
| PubMed | 27068805 | Journal | Sci Rep. 2016 Apr 12;6:24229. doi: 10.1038/srep24229. |
|---|---|---|---|
| Title | Systematic characterization of seminal plasma piRNAs as molecular biomarkers for male infertility. | ||
| Authors | Hong Y, Wang C, Fu Z, Liang H, Zhang S, Lu M, Sun W, Ye C, Zhang CY, Zen K, Shi L, Zhang C, Chen X. | ||