Loading...

Detail Information of piRNA: piR-hsa-2106

General Information
piRBase Id piR-hsa-2106 Accession DQ571812
Organism Human Number of methods 1
Sequence ATTGGTGGTTCAGTGGTAGAATTCTCGCC Number of papers 5
Length 29 Golden piRNA -
Aliases piR-31924; PIR32923;
Datasets
Dataset Accession Reads PubMed Method Tissue
1 N/A N/A 16751776 small RNA testis
300 GSM2222674 7359 29516567 small RNA neuroblastoma cell lines (IMR-32)
301 GSM2222675 50241 29516567 small RNA neuroblastoma cell lines (SH-SY-5Y)
302 GSM4585035 19 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
303 GSM4585036 151 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
305 GSM4585038 30 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
307 GSM4585040 31 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
308 GSM4585041 110 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
310 GSM4585043 66 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
311 GSM4585044 51 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
312 GSM4585045 93 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
313 GSM4585046 116 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
314 GSM4585047 26 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioma, Grade II-III astrocytoma)
315 GSM4585048 28 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioma, Grade II-III astrocytoma)
316 GSM4585049 36 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioma, Grade II-III astrocytoma)
318 GSM4585051 58 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioma, Grade II-III astrocytoma)
320 GSM4020157 146 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Monolayer culture control
321 GSM4020158 212 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Monolayer culture control
322 GSM4020159 374 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Monolayer culture control
323 GSM4020160 219 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Monolayer culture control
324 GSM4020161 401 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Femal; Monolayer culture contro
325 GSM4020162 303 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Monolayer culture contr
326 GSM4020163 394 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Osteogenic differentiatio
327 GSM4020164 316 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Osteogenic differentiatio
328 GSM4020165 331 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Osteogenic differentiatio
329 GSM4020166 198 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Osteogenic differentiatio
330 GSM4020167 624 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Osteogenic differentiat
331 GSM4020168 606 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Osteogenic differentiat
332 GSM4020169 904 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Pellet culture control (d
333 GSM4020170 2407 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Pellet culture control (d
334 GSM4020171 275 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Pellet culture control (d
335 GSM4020172 319 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Pellet culture control (d
336 GSM4020173 1932 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Pellet culture control
337 GSM4020174 1527 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Pellet culture control
338 GSM4020175 758 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Chondrogenic differentiat
339 GSM4020176 1276 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Chondrogenic differentiat
340 GSM4020177 130 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Chondrogenic differentiat
341 GSM4020178 185 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Chondrogenic differentiat
342 GSM4020179 267 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Chondrogenic differenti
343 GSM4020180 275 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Chondrogenic differenti
430 GSM2067753 46 27068805 small RNA Seminal plasma(fertile healthy)
431 GSM2067754 10 27068805 small RNA Seminal plasma(asthenozoospermia)
432 GSM2067755 9 27068805 small RNA Seminal plasma(azoospermia)
Location in GRCh38
12 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 16:70779078-70779107:- VAC14 ENST00000261776; VAC14 ENST00000568886; VAC14 ENST00000568548; ENSG00000279123 ENST00000623856; tRNA tRNA tRNA-Gly-GGY;
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
No record.
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 29516567 Journal Genes Chromosomes Cancer. 2018 Jul;57(7):339-349. doi: 10.1002/gcc.22535.
Title Investigating piwi-interacting RNA regulome in human neuroblastoma.
Authors Roy J, Mallick B.
PubMed 32668808 Journal Int J Mol Sci. 2020 Jul 13;21(14):4954. doi: 10.3390/ijms21144954.
Title Deep Sequencing of Small RNAs from Neurosurgical Extracellular Vesicles Substantiates miR-486-3p as a Circulating Biomarker that Distinguishes Glioblastoma from Lower-Grade Astrocytoma Patients.
Authors Hallal S, Ebrahim Khani S, Wei H, Lee MYT, Sim HW, Sy J, Shivalingam B, Buckland ME, Alexander-Kaufman KL.
PubMed 32050423 Journal Cells. 2020 Feb 9;9(2):398. doi: 10.3390/cells9020398.
Title Differential Regulation of circRNA, miRNA, and piRNA during Early Osteogenic and Chondrogenic Differentiation of Human Mesenchymal Stromal Cells.
Authors Della Bella E, Menzel U, Basoli V, Tourbier C, Alini M, Stoddart MJ.
PubMed 27068805 Journal Sci Rep. 2016 Apr 12;6:24229. doi: 10.1038/srep24229.
Title Systematic characterization of seminal plasma piRNAs as molecular biomarkers for male infertility.
Authors Hong Y, Wang C, Fu Z, Liang H, Zhang S, Lu M, Sun W, Ye C, Zhang CY, Zen K, Shi L, Zhang C, Chen X.