Loading...

Detail Information of piRNA: piR-hsa-21

General Information
piRBase Id piR-hsa-21 Accession DQ588408
Organism Human Number of methods 2
Sequence TGGGAACGAGAAGACACTCGTGGAGGCG Number of papers 5
Length 28 Golden piRNA -
Aliases piR-55520; PIR192863; PIR192280; PIR192301; PIR192315; PIR192325; PIR192331; PIR192343; PIR192375; PIR192399; PIR192407; PIR192421; PIR192450; PIR192476; PIR192492; PIR192509; PIR192523; PIR192548; PIR192577; PIR192589; PIR192621; PIR192643; PIR192655; PIR192679; PIR192687; PIR192722; PIR192750; PIR192784; PIR192805; PIR192832; PIR192836; PIR192883; PIR192912; PIR192939; PIR192978; PIR192987; PIR192991; PIR193020; PIR193032; PIR193042; PIR193083; PIR193109; PIR193121; PIR193132; PIR49519;
Datasets
Dataset Accession Reads PubMed Method Tissue
1 N/A N/A 16751776 small RNA testis
2 N/A N/A 16751777 small RNA testis
3 N/A 15 22313525 small RNA epididymis
176 GSM1584530 3 25818294 small RNA ovary from 2nd trimester embryos
177 GSM1584531 8 25818294 oxidized small RNA ovary from 2nd trimester embryos
178 GSM1584532 4 25818294 oxidized small RNA ovary from 2nd trimester embryos
430 GSM2067753 445 27068805 small RNA Seminal plasma(fertile healthy)
431 GSM2067754 200 27068805 small RNA Seminal plasma(asthenozoospermia)
432 GSM2067755 55 27068805 small RNA Seminal plasma(azoospermia)
Location in GRCh38
43 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 15:101759777-101759805:+ DNM1P47 ENST00000561463; DNM1P47 ENST00000571780;
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
Sample CPM
GSM1584521 0
GSM1584522 0
GSM1584523 0
GSM1584524 0
GSM1584525 0
GSM1584526 0
Sample CPM
GSM1584527 0
GSM1584528 0
GSM1584529 0
GSM1584530 1.4726
GSM1584531 0.9824
GSM1584532 5.018
The Expression of piRNA: piR-hsa-21
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 16751777 Journal Nature. 2006 Jul 13;442(7099):203-7.
Title A novel class of small RNAs bind to MILI protein in mouse testes
Authors Aravin A, Gaidatzis D, Pfeffer S, Lagos-Quintana M, Landgraf P, Iovino N, Morris P, Brownstein MJ, Kuramochi-Miyagawa S, Nakano T, Chien M, Russo JJ, Ju J, Sheridan R, Sander C, Zavolan M, Tuschl T.
PubMed 22313525 Journal Gene. 2012 Apr 15;497(2):330-5.
Title Deep sequencing analysis of small non-coding RNAs reveals the diversity of microRNAs and piRNAs in the human epididymis.
Authors Li Y, Wang HY, Wan FC, Liu FJ, Liu J, Zhang N, Jin SH, Li JY.
PubMed 25818294 Journal Cell Rep. 2015 Mar 31;10(12):2069-82.
Title Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.
PubMed 27068805 Journal Sci Rep. 2016 Apr 12;6:24229. doi: 10.1038/srep24229.
Title Systematic characterization of seminal plasma piRNAs as molecular biomarkers for male infertility.
Authors Hong Y, Wang C, Fu Z, Liang H, Zhang S, Lu M, Sun W, Ye C, Zhang CY, Zen K, Shi L, Zhang C, Chen X.