Loading...

Detail Information of piRNA: piR-hsa-20281

General Information
piRBase Id piR-hsa-20281 Accession DQ590028
Organism Human Number of methods 1
Sequence TGGTCTCGAACTCCTGACCTCAGGTGATC Number of papers 4
Length 29 Golden piRNA -
Aliases piR-57140; PIR51139;
Datasets
Dataset Accession Reads PubMed Method Tissue
1 N/A N/A 16751776 small RNA testis
268 GSM3517637 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult)
269 GSM3517638 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult)
270 GSM3517639 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult)
271 GSM3517641 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult; spike in)
300 GSM2222674 65 29516567 small RNA neuroblastoma cell lines (IMR-32)
301 GSM2222675 352 29516567 small RNA neuroblastoma cell lines (SH-SY-5Y)
430 GSM2067753 12 27068805 small RNA Seminal plasma(fertile healthy)
431 GSM2067754 10 27068805 small RNA Seminal plasma(asthenozoospermia)
Location in GRCh38
25561 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 18:2896388-2896417:+ EMILIN2 ENST00000254528; SINE Alu AluSx1;
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
No record.
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
Id in article Disease Subtype Expression Function PubMed
DQ590028 Bladder cancer up-regulated FC 2.5 25305452
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 31358756 Journal Nat Commun. 2019 Jul 29;10(1):3389. doi: 10.1038/s41467-019-11312-8.
Title Single-cell CAS-seq reveals a class of short PIWI-interacting RNAs in human oocytes.
Authors Yang Q, Li R, Lyu Q, Hou L, Liu Z, Sun Q, Liu M, Shi H, Xu B, Yin M, Yan Z,Huang Y, Liu M, Li Y, Wu L.
PubMed 29516567 Journal Genes Chromosomes Cancer. 2018 Jul;57(7):339-349. doi: 10.1002/gcc.22535.
Title Investigating piwi-interacting RNA regulome in human neuroblastoma.
Authors Roy J, Mallick B.
PubMed 27068805 Journal Sci Rep. 2016 Apr 12;6:24229. doi: 10.1038/srep24229.
Title Systematic characterization of seminal plasma piRNAs as molecular biomarkers for male infertility.
Authors Hong Y, Wang C, Fu Z, Liang H, Zhang S, Lu M, Sun W, Ye C, Zhang CY, Zen K, Shi L, Zhang C, Chen X.
PubMed 25305452 Journal Cancer Lett. 2015 Jan 28;356(2 Pt B):561-7. doi: 10.1016/j.canlet.2014.10.004. Epub 2014 Oct 8.
Title Identification of novel piRNAs in bladder cancer
Authors Chu H, Hui G, Yuan L, Shi D, Wang Y, Du M, Zhong D, Ma L, Tong N, Qin C, Yin C, Zhang Z, Wang M.