Loading...
piRBase Id | piR-hsa-20281 | Accession | DQ590028 |
---|---|---|---|
Organism | Human | Number of methods | 1 |
Sequence | TGGTCTCGAACTCCTGACCTCAGGTGATC | Number of papers | 4 |
Length | 29 | Golden piRNA | - |
Aliases | piR-57140; PIR51139; |
Dataset | Accession | Reads | PubMed | Method | Tissue |
---|---|---|---|---|---|
1 | N/A | N/A | 16751776 | small RNA | testis |
268 | GSM3517637 | N/A | 31358756 | samll RNA(CAS-seq) | oocyte(age: adult) |
269 | GSM3517638 | N/A | 31358756 | samll RNA(CAS-seq) | oocyte(age: adult) |
270 | GSM3517639 | N/A | 31358756 | samll RNA(CAS-seq) | oocyte(age: adult) |
271 | GSM3517641 | N/A | 31358756 | samll RNA(CAS-seq) | oocyte(age: adult; spike in) |
300 | GSM2222674 | 65 | 29516567 | small RNA | neuroblastoma cell lines (IMR-32) |
301 | GSM2222675 | 352 | 29516567 | small RNA | neuroblastoma cell lines (SH-SY-5Y) |
430 | GSM2067753 | 12 | 27068805 | small RNA | Seminal plasma(fertile healthy) |
431 | GSM2067754 | 10 | 27068805 | small RNA | Seminal plasma(asthenozoospermia) |
No. | Location | Gene | RepeatMaker |
---|---|---|---|
Location 1 | 18:2896388-2896417:+ | EMILIN2 ENST00000254528; | SINE Alu AluSx1; |
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC |
No record. |
No record. |
No record. |
No record. |
Id in article | Disease | Subtype | Expression | Function | PubMed |
---|---|---|---|---|---|
DQ590028 | Bladder cancer | up-regulated FC 2.5 | 25305452 |
PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
---|---|---|---|
Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. |
PubMed | 31358756 | Journal | Nat Commun. 2019 Jul 29;10(1):3389. doi: 10.1038/s41467-019-11312-8. |
---|---|---|---|
Title | Single-cell CAS-seq reveals a class of short PIWI-interacting RNAs in human oocytes. | ||
Authors | Yang Q, Li R, Lyu Q, Hou L, Liu Z, Sun Q, Liu M, Shi H, Xu B, Yin M, Yan Z,Huang Y, Liu M, Li Y, Wu L. |
PubMed | 29516567 | Journal | Genes Chromosomes Cancer. 2018 Jul;57(7):339-349. doi: 10.1002/gcc.22535. |
---|---|---|---|
Title | Investigating piwi-interacting RNA regulome in human neuroblastoma. | ||
Authors | Roy J, Mallick B. |
PubMed | 27068805 | Journal | Sci Rep. 2016 Apr 12;6:24229. doi: 10.1038/srep24229. |
---|---|---|---|
Title | Systematic characterization of seminal plasma piRNAs as molecular biomarkers for male infertility. | ||
Authors | Hong Y, Wang C, Fu Z, Liang H, Zhang S, Lu M, Sun W, Ye C, Zhang CY, Zen K, Shi L, Zhang C, Chen X. |
PubMed | 25305452 | Journal | Cancer Lett. 2015 Jan 28;356(2 Pt B):561-7. doi: 10.1016/j.canlet.2014.10.004. Epub 2014 Oct 8. |
---|---|---|---|
Title | Identification of novel piRNAs in bladder cancer | ||
Authors | Chu H, Hui G, Yuan L, Shi D, Wang Y, Du M, Zhong D, Ma L, Tong N, Qin C, Yin C, Zhang Z, Wang M. |