Loading...

Detail Information of piRNA: piR-hsa-20198

General Information
piRBase Id piR-hsa-20198 Accession DQ589945
Organism Human Number of methods 2
Sequence TGGTCAGAGAGGACTTGATCAGTGGTGGC Number of papers 2
Length 29 Golden piRNA -
Aliases piR-57057; PIR51056;
Datasets
Dataset Accession Reads PubMed Method Tissue
1 N/A N/A 16751776 small RNA testis
286 GSM3517671 N/A 31358756 oxidized small RNA oocyte(age: adult; spike in)
287 GSM3517672 N/A 31358756 oxidized small RNA oocyte(age: adult; spike in)
Location in GRCh38
10 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 13:18746111-18746140:- Satellite Satellite HSAT5;
Location 2 2:94763916-94763945:- Satellite Satellite HSAT5;
Location 3 20:30632377-30632406:- Satellite Satellite HSAT5;
Location 4 4:49214693-49214722:- Satellite Satellite HSAT5;
Location 5 9:40321947-40321976:+ ENSG00000240240 ENST00000659103; ENSG00000240240 ENST00000654136; ENSG00000240240 ENST00000590154; ENSG00000240240 ENST00000421686; FAM95B1 ENST00000455995; Satellite Satellite HSAT5;
Location 6 9:42946993-42947022:+ ANKRD20A7P ENST00000666959; Satellite Satellite HSAT5;
Location 7 9:64461975-64462004:+ Satellite Satellite HSAT5;
Location 8 9:66054328-66054357:- ENSG00000286945 ENST00000668069; ENSG00000274628 ENST00000620585; Satellite Satellite HSAT5;
Location 9 CHR_HG2525_PATCH:49214693-49214722:-
Location 10 CHR_HSCHR13_1_CTG3:18746111-18746140:-
piRNA Expression
No record.
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 31358756 Journal Nat Commun. 2019 Jul 29;10(1):3389. doi: 10.1038/s41467-019-11312-8.
Title Single-cell CAS-seq reveals a class of short PIWI-interacting RNAs in human oocytes.
Authors Yang Q, Li R, Lyu Q, Hou L, Liu Z, Sun Q, Liu M, Shi H, Xu B, Yin M, Yan Z,Huang Y, Liu M, Li Y, Wu L.