Loading...

Detail Information of piRNA: piR-hsa-2

General Information
piRBase Id piR-hsa-2 Accession N/A
Organism Human Number of methods 1
Sequence ACGCCTCCACGTAGTGTCTT Number of papers 1
Length 20 Golden piRNA -
Aliases PIR192552; PIR192869; PIR192286; PIR192298; PIR192307; PIR192320; PIR192328; PIR192338; PIR192350; PIR192377; PIR192405; PIR192414; PIR192425; PIR192448; PIR192458; PIR192482; PIR192494; PIR192516; PIR192529; PIR192579; PIR192597; PIR192615; PIR192628; PIR192651; PIR192660; PIR192682; PIR192694; PIR192716; PIR192725; PIR192745; PIR192755; PIR192789; PIR192812; PIR192834; PIR192843; PIR192887; PIR192906; PIR192915; PIR192935; PIR192946; PIR192980; PIR192989; PIR192998; PIR193025; PIR193036; PIR193048; PIR193054; PIR193078; PIR193089; PIR193116; PIR193126; PIR193137;
Datasets
Dataset Accession Reads PubMed Method Tissue
2 N/A N/A 16751777 small RNA testis
Location in GRCh38
No loci found in GRCh38!
To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
No record.
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751777 Journal Nature. 2006 Jul 13;442(7099):203-7.
Title A novel class of small RNAs bind to MILI protein in mouse testes
Authors Aravin A, Gaidatzis D, Pfeffer S, Lagos-Quintana M, Landgraf P, Iovino N, Morris P, Brownstein MJ, Kuramochi-Miyagawa S, Nakano T, Chien M, Russo JJ, Ju J, Sheridan R, Sander C, Zavolan M, Tuschl T.