Loading...
piRBase Id | piR-hsa-1883938 | Accession | N/A |
---|---|---|---|
Organism | Human | Number of methods | 1 |
Sequence | GATGAGAGCATTGTTCTGAGCCAGG | Number of papers | 1 |
Length | 25 | Golden piRNA | - |
Aliases | N/A |
Dataset | Accession | Reads | PubMed | Method | Tissue |
---|---|---|---|---|---|
171 | GSM1584525 | 1 | 25818294 | small RNA | ovary from 1st trimester embryos |
175 | GSM1584529 | 1 | 25818294 | small RNA | ovary from 2nd trimester embryos |
No. | Location | Gene | RepeatMaker |
---|---|---|---|
Location 1 | 1:30968163-30968188:- | PUM1 ENST00000426105; PUM1 ENST00000373747; PUM1 ENST00000257075; PUM1 ENST00000424085; PUM1 ENST00000525843; PUM1 ENST00000440538; PUM1 ENST00000498419; PUM1 ENST00000373741; PUM1 ENST00000373742; PUM1 ENST00000471894; PUM1 ENST00000490546; PUM1 ENST00000532678; |
Sample | CPM |
---|---|
GSM1584521 | 0 |
GSM1584522 | 0 |
GSM1584523 | 0 |
GSM1584524 | 0 |
GSM1584525 | 0.6307 |
GSM1584526 | 0 |
Sample | CPM |
---|---|
GSM1584527 | 0 |
GSM1584528 | 0 |
GSM1584529 | 0.4447 |
GSM1584530 | 0 |
GSM1584531 | 0 |
GSM1584532 | 0 |
No record. |
No record. |
No record. |
No record. |
PubMed | 25818294 | Journal | Cell Rep. 2015 Mar 31;10(12):2069-82. |
---|---|---|---|
Title | Piwi proteins and piRNAs in mammalian oocytes and early embryos. | ||
Authors | Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF. |