Loading...
| piRBase Id | piR-hsa-18348 | Accession | DQ588101 |
|---|---|---|---|
| Organism | Human | Number of methods | 1 |
| Sequence | TGGCTATGATCTGCCTTGTTCAAGCTGAGA | Number of papers | 3 |
| Length | 30 | Golden piRNA | - |
| Aliases | piR-55213; PIR49212; | ||
| Dataset | Accession | Reads | PubMed | Method | Tissue |
|---|---|---|---|---|---|
| 1 | N/A | N/A | 16751776 | small RNA | testis |
| 289 | GSM1386593 | 3 | 26095918 | samll RNA | Lung(cell line: HBE2; cell type: Immortalized bronchial epithelial) |
| 290 | GSM1386594 | 3 | 26095918 | samll RNA | Lung(cell line: HBE3; cell type: Immortalized bronchial epithelial) |
| 291 | GSM1386595 | 16 | 26095918 | samll RNA | Lung(cell line: HBE4; cell type: Immortalized bronchial epithelial) |
| 292 | GSM1386596 | 9 | 26095918 | samll RNA | Lung(cell line: H522; cell type: Adenocarcinoma (NSCLC)) |
| 293 | GSM1386597 | 5 | 26095918 | samll RNA | Lung(cell line: H1437; cell type: Adenocarcinoma (NSCLC)) |
| 294 | GSM1386598 | 3 | 26095918 | samll RNA | Lung(cell line: H1792; cell type: Adenocarcinoma (NSCLC)) |
| 295 | GSM1386599 | 3 | 26095918 | samll RNA | Lung(cell line: H1944; cell type: Adenocarcinoma (NSCLC)) |
| 296 | GSM1386600 | 11 | 26095918 | samll RNA | Lung(cell line: H157; cell type: Squamous (NSCLC)) |
| 297 | GSM1386601 | 32 | 26095918 | samll RNA | Lung(cell line: H226; cell type: Squamous (NSCLC)) |
| 298 | GSM1386602 | 12 | 26095918 | samll RNA | Lung(cell line: H596; cell type: Squamous (NSCLC)) |
| 299 | GSM1386603 | 7 | 26095918 | samll RNA | Lung(cell line: SKMES1; cell type: Squamous (NSCLC)) |
| 300 | GSM2222674 | 115 | 29516567 | small RNA | neuroblastoma cell lines (IMR-32) |
| 301 | GSM2222675 | 360 | 29516567 | small RNA | neuroblastoma cell lines (SH-SY-5Y) |
| No. | Location | Gene | RepeatMaker |
|---|---|---|---|
| Location 1 | 2:233288908-233288938:+ | ATG16L1 ENST00000347464; ATG16L1 ENST00000373525; ATG16L1 ENST00000392021; ATG16L1 ENST00000392017; ATG16L1 ENST00000479942; ATG16L1 ENST00000474148; ATG16L1 ENST00000392020; ATG16L1 ENST00000392018; ATG16L1 ENST00000498620; ATG16L1 ENST00000464645; SCARNA6 ENST00000515982; | |
| Location 2 | CHR_HG2232_PATCH:233288908-233288938:+ |
| No record. |
| No record. |
| No record. |
| No record. |
| No record. |
| PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
|---|---|---|---|
| Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
| Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. | ||
| PubMed | 26095918 | Journal | Nat Commun. 2015 Jun 22;6:7316. doi: 10.1038/ncomms8316. |
|---|---|---|---|
| Title | A piRNA-like small RNA interacts with and modulates p-ERM proteins in human somatic cells. | ||
| Authors | Mei Y, Wang Y, Kumari P, Shetty AC, Clark D, Gable T, MacKerell AD, Ma MZ, Weber DJ, Yang AJ, Edelman MJ, Mao L. | ||
| PubMed | 29516567 | Journal | Genes Chromosomes Cancer. 2018 Jul;57(7):339-349. doi: 10.1002/gcc.22535. |
|---|---|---|---|
| Title | Investigating piwi-interacting RNA regulome in human neuroblastoma. | ||
| Authors | Roy J, Mallick B. | ||