Loading...

Detail Information of piRNA: piR-hsa-17804

General Information
piRBase Id piR-hsa-17804 Accession DQ587514
Organism Human Number of methods 2
Sequence TGGCAATGATGACCCACTTGCCCTCACTGA Number of papers 3
Length 30 Golden piRNA Y
Aliases piR-54626; PIR48625;
Datasets
Dataset Accession Reads PubMed Method Tissue
1 N/A N/A 16751776 small RNA testis
167 GSM1584521 6 25818294 small RNA adult ovary
168 GSM1584522 1 25818294 small RNA adult ovary
169 GSM1584523 133 25818294 oxidized small RNA adult ovary
170 GSM1584524 38 25818294 oxidized small RNA adult ovary
171 GSM1584525 9 25818294 small RNA ovary from 1st trimester embryos
172 GSM1584526 16 25818294 small RNA ovary from 1st trimester embryos
173 GSM1584527 2 25818294 oxidized small RNA ovary from 1st trimester embryos
176 GSM1584530 1 25818294 small RNA ovary from 2nd trimester embryos
177 GSM1584531 2 25818294 oxidized small RNA ovary from 2nd trimester embryos
300 GSM2222674 N/A 29516567 small RNA neuroblastoma cell lines (IMR-32)
301 GSM2222675 N/A 29516567 small RNA neuroblastoma cell lines (SH-SY-5Y)
Location in GRCh38
2 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 1:30935741-30935771:- PUM1 ENST00000426105; PUM1 ENST00000373747; PUM1 ENST00000257075; PUM1 ENST00000424085; PUM1 ENST00000525843; PUM1 ENST00000440538; PUM1 ENST00000498419; PUM1 ENST00000373741; PUM1 ENST00000373742; PUM1 ENST00000530669;
Location 2 1:30949170-30949200:- PUM1 ENST00000426105; PUM1 ENST00000373747; PUM1 ENST00000257075; PUM1 ENST00000424085; PUM1 ENST00000525843; PUM1 ENST00000440538; PUM1 ENST00000498419; PUM1 ENST00000373741; PUM1 ENST00000373742; PUM1 ENST00000529846; PUM1 ENST00000525997; PUM1 ENST00000527498;
piRNA Expression
Sample CPM
GSM1584521 5.3923
GSM1584522 0.6903
GSM1584523 126.5879
GSM1584524 33.1367
GSM1584525 5.6767
GSM1584526 10.3594
Sample CPM
GSM1584527 2.8767
GSM1584528 0
GSM1584529 0
GSM1584530 0.4909
GSM1584531 0.2456
GSM1584532 0
The Expression of piRNA: piR-hsa-17804
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 25818294 Journal Cell Rep. 2015 Mar 31;10(12):2069-82.
Title Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.
PubMed 29516567 Journal Genes Chromosomes Cancer. 2018 Jul;57(7):339-349. doi: 10.1002/gcc.22535.
Title Investigating piwi-interacting RNA regulome in human neuroblastoma.
Authors Roy J, Mallick B.