Loading...
| piRBase Id | piR-hsa-17770 | Accession | DQ587480 |
|---|---|---|---|
| Organism | Human | Number of methods | 1 |
| Sequence | TGGCAACCGCCCCGTCTGAGAAGTGA | Number of papers | 1 |
| Length | 26 | Golden piRNA | - |
| Aliases | piR-54592; PIR48591; | ||
| No. | Location | Gene | RepeatMaker |
|---|---|---|---|
| Location 1 | 3:98838277-98838303:- | DCBLD2 ENST00000326840; DCBLD2 ENST00000326857; DCBLD2 ENST00000469648; DCBLD2 ENST00000486004; | Retroposon SVA SVA_F; |
| Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC | |||
| No record. |
| No record. |
| No record. |
| No record. |
| No record. |
| PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
|---|---|---|---|
| Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
| Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. | ||