Loading...
piRBase Id | piR-hsa-1748 | Accession | DQ571425 |
---|---|---|---|
Organism | Human | Number of methods | 1 |
Sequence | AGTAGAGACAGGGTTTCACCATGTTGGCCA | Number of papers | 4 |
Length | 30 | Golden piRNA | - |
Aliases | piR-31537; PIR32536; |
Dataset | Accession | Reads | PubMed | Method | Tissue |
---|---|---|---|---|---|
1 | N/A | N/A | 16751776 | small RNA | testis |
300 | GSM2222674 | 42 | 29516567 | small RNA | neuroblastoma cell lines (IMR-32) |
301 | GSM2222675 | 215 | 29516567 | small RNA | neuroblastoma cell lines (SH-SY-5Y) |
306 | GSM4585039 | 27 | 32668808 | small RNA | Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma) |
316 | GSM4585049 | 28 | 32668808 | small RNA | Brain, Neurosurgical fluid, Extracellular Vesicles(Glioma, Grade II-III astrocytoma) |
317 | GSM4585050 | 94 | 32668808 | small RNA | Brain, Neurosurgical fluid, Extracellular Vesicles(Glioma, Grade II-III astrocytoma) |
329 | GSM4020166 | 1 | 32050423 | small RNA | mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Osteogenic differentiatio |
333 | GSM4020170 | 1 | 32050423 | small RNA | mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Pellet culture control (d |
334 | GSM4020171 | 3 | 32050423 | small RNA | mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Pellet culture control (d |
336 | GSM4020173 | 4 | 32050423 | small RNA | mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Pellet culture control |
337 | GSM4020174 | 1 | 32050423 | small RNA | mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Pellet culture control |
338 | GSM4020175 | 3 | 32050423 | small RNA | mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Chondrogenic differentiat |
339 | GSM4020176 | 5 | 32050423 | small RNA | mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Chondrogenic differentiat |
340 | GSM4020177 | 1 | 32050423 | small RNA | mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Chondrogenic differentiat |
341 | GSM4020178 | 2 | 32050423 | small RNA | mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Chondrogenic differentiat |
343 | GSM4020180 | 2 | 32050423 | small RNA | mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Chondrogenic differenti |
No. | Location | Gene | RepeatMaker |
---|---|---|---|
Location 1 | 20:34461516-34461546:- | ITCH ENST00000374864; ITCH ENST00000535650; ITCH ENST00000670516; ITCH ENST00000665484; ITCH ENST00000664852; ITCH ENST00000660337; ITCH ENST00000262650; ITCH ENST00000665346; ITCH ENST00000483727; ITCH ENST00000662871; | SINE Alu AluSg; |
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC |
No record. |
No record. |
No record. |
No record. |
No record. |
PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
---|---|---|---|
Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. |
PubMed | 29516567 | Journal | Genes Chromosomes Cancer. 2018 Jul;57(7):339-349. doi: 10.1002/gcc.22535. |
---|---|---|---|
Title | Investigating piwi-interacting RNA regulome in human neuroblastoma. | ||
Authors | Roy J, Mallick B. |
PubMed | 32668808 | Journal | Int J Mol Sci. 2020 Jul 13;21(14):4954. doi: 10.3390/ijms21144954. |
---|---|---|---|
Title | Deep Sequencing of Small RNAs from Neurosurgical Extracellular Vesicles Substantiates miR-486-3p as a Circulating Biomarker that Distinguishes Glioblastoma from Lower-Grade Astrocytoma Patients. | ||
Authors | Hallal S, Ebrahim Khani S, Wei H, Lee MYT, Sim HW, Sy J, Shivalingam B, Buckland ME, Alexander-Kaufman KL. |
PubMed | 32050423 | Journal | Cells. 2020 Feb 9;9(2):398. doi: 10.3390/cells9020398. |
---|---|---|---|
Title | Differential Regulation of circRNA, miRNA, and piRNA during Early Osteogenic and Chondrogenic Differentiation of Human Mesenchymal Stromal Cells. | ||
Authors | Della Bella E, Menzel U, Basoli V, Tourbier C, Alini M, Stoddart MJ. |