Loading...
piRBase Id | piR-hsa-1745 | Accession | DQ571422 |
---|---|---|---|
Organism | Human | Number of methods | 1 |
Sequence | AGTAATGGGATTGCTGGGTCAAATGGTA | Number of papers | 3 |
Length | 28 | Golden piRNA | - |
Aliases | piR-31534; PIR32533; |
Dataset | Accession | Reads | PubMed | Method | Tissue |
---|---|---|---|---|---|
1 | N/A | N/A | 16751776 | small RNA | testis |
301 | GSM2222675 | N/A | 29516567 | small RNA | neuroblastoma cell lines (SH-SY-5Y) |
316 | GSM4585049 | 48 | 32668808 | small RNA | Brain, Neurosurgical fluid, Extracellular Vesicles(Glioma, Grade II-III astrocytoma) |
317 | GSM4585050 | 124 | 32668808 | small RNA | Brain, Neurosurgical fluid, Extracellular Vesicles(Glioma, Grade II-III astrocytoma) |
No. | Location | Gene | RepeatMaker |
---|---|---|---|
Location 1 | 3:13730911-13730939:+ | LINC00620 ENST00000438915; LINC00620 ENST00000419618; LINC00620 ENST00000665476; | LINE L1 L1PA7; |
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC |
No record. |
No record. |
No record. |
No record. |
No record. |
PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
---|---|---|---|
Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. |
PubMed | 29516567 | Journal | Genes Chromosomes Cancer. 2018 Jul;57(7):339-349. doi: 10.1002/gcc.22535. |
---|---|---|---|
Title | Investigating piwi-interacting RNA regulome in human neuroblastoma. | ||
Authors | Roy J, Mallick B. |
PubMed | 32668808 | Journal | Int J Mol Sci. 2020 Jul 13;21(14):4954. doi: 10.3390/ijms21144954. |
---|---|---|---|
Title | Deep Sequencing of Small RNAs from Neurosurgical Extracellular Vesicles Substantiates miR-486-3p as a Circulating Biomarker that Distinguishes Glioblastoma from Lower-Grade Astrocytoma Patients. | ||
Authors | Hallal S, Ebrahim Khani S, Wei H, Lee MYT, Sim HW, Sy J, Shivalingam B, Buckland ME, Alexander-Kaufman KL. |