Loading...

Detail Information of piRNA: piR-hsa-1698

General Information
piRBase Id piR-hsa-1698 Accession DQ571375
Organism Human Number of methods 2
Sequence AGGTAGAAGAGGGTGTTGGAAACCAAGT Number of papers 3
Length 28 Golden piRNA Y
Aliases piR-31487; PIR32486;
Datasets
Dataset Accession Reads PubMed Method Tissue
1 N/A N/A 16751776 small RNA testis
174 GSM1584528 1 25818294 oxidized small RNA ovary from 1st trimester embryos
175 GSM1584529 39 25818294 small RNA ovary from 2nd trimester embryos
176 GSM1584530 27 25818294 small RNA ovary from 2nd trimester embryos
177 GSM1584531 682 25818294 oxidized small RNA ovary from 2nd trimester embryos
178 GSM1584532 42 25818294 oxidized small RNA ovary from 2nd trimester embryos
430 GSM2067753 2 27068805 small RNA Seminal plasma(fertile healthy)
Location in GRCh38
10 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 X:9405340-9405368:- ENSG00000282306 ENST00000633785;
Location 2 X:9406385-9406413:- ENSG00000282501 ENST00000631601;
Location 3 X:9407316-9407344:- ENSG00000282358 ENST00000631952;
Location 4 X:9408247-9408275:- ENSG00000282668 ENST00000633241;
Location 5 X:9409178-9409206:- ENSG00000282299 ENST00000631993;
Location 6 X:9410109-9410137:- ENSG00000282697 ENST00000633298;
Location 7 X:9411154-9411182:- ENSG00000282222 ENST00000632688;
Location 8 X:9412086-9412114:- ENSG00000281955 ENST00000631611;
Location 9 X:9413131-9413159:- ENSG00000281941 ENST00000631903;
Location 10 X:9414176-9414204:- ENSG00000282300 ENST00000632293;
piRNA Expression
Sample CPM
GSM1584521 0
GSM1584522 0
GSM1584523 0
GSM1584524 0
GSM1584525 0
GSM1584526 0
Sample CPM
GSM1584527 0
GSM1584528 106.4623
GSM1584529 17.3449
GSM1584530 13.2536
GSM1584531 83.7471
GSM1584532 52.6889
The Expression of piRNA: piR-hsa-1698
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 25818294 Journal Cell Rep. 2015 Mar 31;10(12):2069-82.
Title Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.
PubMed 27068805 Journal Sci Rep. 2016 Apr 12;6:24229. doi: 10.1038/srep24229.
Title Systematic characterization of seminal plasma piRNAs as molecular biomarkers for male infertility.
Authors Hong Y, Wang C, Fu Z, Liang H, Zhang S, Lu M, Sun W, Ye C, Zhang CY, Zen K, Shi L, Zhang C, Chen X.