Loading...

Detail Information of piRNA: piR-hsa-1681

General Information
piRBase Id piR-hsa-1681 Accession DQ571358
Organism Human Number of methods 1
Sequence AGGGTGCTGATTGGTGTGTTTACAAACCTT Number of papers 2
Length 30 Golden piRNA -
Aliases piR-31470; PIR32469;
Datasets
Dataset Accession Reads PubMed Method Tissue
1 N/A N/A 16751776 small RNA testis
175 GSM1584529 1 25818294 small RNA ovary from 2nd trimester embryos
176 GSM1584530 2 25818294 small RNA ovary from 2nd trimester embryos
Location in GRCh38
1102 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 15:68975477-68975507:+ ENSG00000137808 ENST00000557966; NOX5 ENST00000260364; NOX5 ENST00000448182; NOX5 ENST00000455873; LTR ERV1 LTR12C;
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
Sample CPM
GSM1584521 0
GSM1584522 0
GSM1584523 0
GSM1584524 0
GSM1584525 0
GSM1584526 0
Sample CPM
GSM1584527 0
GSM1584528 0
GSM1584529 0.4447
GSM1584530 0.9817
GSM1584531 0
GSM1584532 0
The Expression of piRNA: piR-hsa-1681
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 25818294 Journal Cell Rep. 2015 Mar 31;10(12):2069-82.
Title Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.