Loading...

Detail Information of piRNA: piR-hsa-166356

General Information
piRBase Id piR-hsa-166356 Accession N/A
Organism Human Number of methods 1
Sequence ACTGATGAGAGCATTGTTCTGAGA Number of papers 1
Length 24 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
167 GSM1584521 1 25818294 small RNA adult ovary
Location in GRCh38
1 best hit(s) with 1 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 1:30968167-30968191:- PUM1 ENST00000426105; PUM1 ENST00000373747; PUM1 ENST00000257075; PUM1 ENST00000424085; PUM1 ENST00000525843; PUM1 ENST00000440538; PUM1 ENST00000498419; PUM1 ENST00000373741; PUM1 ENST00000373742; PUM1 ENST00000471894; PUM1 ENST00000490546; PUM1 ENST00000532678;
piRNA Expression
The Expression of piRNA: piR-hsa-166356
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 25818294 Journal Cell Rep. 2015 Mar 31;10(12):2069-82.
Title Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.