Loading...

Detail Information of piRNA: piR-hsa-166131

General Information
piRBase Id piR-hsa-166131 Accession N/A
Organism Human Number of methods 2
Sequence TAAGTTGCAATACTTAATTTCTGCCA Number of papers 1
Length 26 Golden piRNA Y
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
167 GSM1584521 1 25818294 small RNA adult ovary
168 GSM1584522 3 25818294 small RNA adult ovary
169 GSM1584523 8 25818294 oxidized small RNA adult ovary
170 GSM1584524 18 25818294 oxidized small RNA adult ovary
171 GSM1584525 4 25818294 small RNA ovary from 1st trimester embryos
172 GSM1584526 6 25818294 small RNA ovary from 1st trimester embryos
173 GSM1584527 22 25818294 oxidized small RNA ovary from 1st trimester embryos
175 GSM1584529 4 25818294 small RNA ovary from 2nd trimester embryos
176 GSM1584530 1 25818294 small RNA ovary from 2nd trimester embryos
177 GSM1584531 13 25818294 oxidized small RNA ovary from 2nd trimester embryos
178 GSM1584532 4 25818294 oxidized small RNA ovary from 2nd trimester embryos
Location in GRCh38
1 best hit(s) with 1 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 1:630726-630752:+ ENSG00000230021 ENST00000419394; ENSG00000230021 ENST00000634337; ENSG00000230021 ENST00000635509; ENSG00000230021 ENST00000648019; ENSG00000230021 ENST00000440200; ENSG00000230021 ENST00000440196; ENSG00000230021 ENST00000641296; ENSG00000230021 ENST00000452176;
piRNA Expression
Sample CPM
GSM1584521 0.8987
GSM1584522 2.0709
GSM1584523 7.6143
GSM1584524 15.6963
GSM1584525 2.523
GSM1584526 3.8848
Sample CPM
GSM1584527 31.6442
GSM1584528 0
GSM1584529 1.779
GSM1584530 0.4909
GSM1584531 1.5964
GSM1584532 5.018
The Expression of piRNA: piR-hsa-166131
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 25818294 Journal Cell Rep. 2015 Mar 31;10(12):2069-82.
Title Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.