Loading...

Detail Information of piRNA: piR-hsa-16422

General Information
piRBase Id piR-hsa-16422 Accession DQ586201
Organism Human Number of methods 2
Sequence TGCTTAAGGTTGTATCAAGGTTAGTC Number of papers 3
Length 26 Golden piRNA Y
Aliases piR-53313; PIR47312;
Datasets
Dataset Accession Reads PubMed Method Tissue
1 N/A N/A 16751776 small RNA testis
170 GSM1584524 1 25818294 oxidized small RNA adult ovary
174 GSM1584528 1 25818294 oxidized small RNA ovary from 1st trimester embryos
175 GSM1584529 24 25818294 small RNA ovary from 2nd trimester embryos
176 GSM1584530 6 25818294 small RNA ovary from 2nd trimester embryos
177 GSM1584531 189 25818294 oxidized small RNA ovary from 2nd trimester embryos
178 GSM1584532 8 25818294 oxidized small RNA ovary from 2nd trimester embryos
280 GSM3517660 N/A 31358756 IP Input oocyte(age: adult)
Location in GRCh38
1 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 4:10118591-10118617:+
piRNA Expression
Sample CPM
GSM1584521 0
GSM1584522 0
GSM1584523 0
GSM1584524 0.872
GSM1584525 0
GSM1584526 0
Sample CPM
GSM1584527 0
GSM1584528 106.4623
GSM1584529 10.6738
GSM1584530 2.9452
GSM1584531 23.2085
GSM1584532 10.036
The Expression of piRNA: piR-hsa-16422
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 25818294 Journal Cell Rep. 2015 Mar 31;10(12):2069-82.
Title Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.
PubMed 31358756 Journal Nat Commun. 2019 Jul 29;10(1):3389. doi: 10.1038/s41467-019-11312-8.
Title Single-cell CAS-seq reveals a class of short PIWI-interacting RNAs in human oocytes.
Authors Yang Q, Li R, Lyu Q, Hou L, Liu Z, Sun Q, Liu M, Shi H, Xu B, Yin M, Yan Z,Huang Y, Liu M, Li Y, Wu L.