Loading...
| piRBase Id | piR-hsa-1626 | Accession | DQ571289 |
|---|---|---|---|
| Organism | Human | Number of methods | 1 |
| Sequence | AGGGAGGCGACCACCAGGAAGAGTGAGGG | Number of papers | 1 |
| Length | 29 | Golden piRNA | - |
| Aliases | piR-31401; PIR32400; | ||
| No. | Location | Gene | RepeatMaker |
|---|---|---|---|
| Location 1 | 1:179589275-179589304:- | Simple_repeat Simple_repeat (CCAC)n; |
| No record. |
| No record. |
| No record. |
| No record. |
| No record. |
| PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
|---|---|---|---|
| Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
| Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. | ||