Loading...

Detail Information of piRNA: piR-hsa-16

General Information
piRBase Id piR-hsa-16 Accession DQ578300
Organism Human Number of methods 2
Sequence TCTTCTCGGAGCTGCTGTCCAACCTGTACTC Number of papers 4
Length 31 Golden piRNA Y
Aliases piR-46412; PIR192566; PIR192364; PIR192390; PIR192438; PIR192466; PIR192505; PIR192539; PIR192608; PIR192640; PIR192706; PIR192732; PIR192767; PIR192799; PIR192825; PIR192855; PIR192897; PIR192921; PIR192959; PIR193011; PIR193065; PIR193101; PIR193148; PIR193159; PIR39411;
Datasets
Dataset Accession Reads PubMed Method Tissue
1 N/A N/A 16751776 small RNA testis
2 N/A N/A 16751777 small RNA testis
167 GSM1584521 1 25818294 small RNA adult ovary
168 GSM1584522 1 25818294 small RNA adult ovary
169 GSM1584523 6 25818294 oxidized small RNA adult ovary
170 GSM1584524 9 25818294 oxidized small RNA adult ovary
175 GSM1584529 2 25818294 small RNA ovary from 2nd trimester embryos
177 GSM1584531 24 25818294 oxidized small RNA ovary from 2nd trimester embryos
178 GSM1584532 2 25818294 oxidized small RNA ovary from 2nd trimester embryos
430 GSM2067753 4 27068805 small RNA Seminal plasma(fertile healthy)
432 GSM2067755 1 27068805 small RNA Seminal plasma(azoospermia)
Location in GRCh38
32 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 CHR_HSCHR15_6_CTG8:31968267-31968298:+
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
Sample CPM
GSM1584521 0.8987
GSM1584522 0.6903
GSM1584523 5.7107
GSM1584524 7.8482
GSM1584525 0
GSM1584526 0
Sample CPM
GSM1584527 0
GSM1584528 0
GSM1584529 0.8895
GSM1584530 0
GSM1584531 2.9471
GSM1584532 2.509
The Expression of piRNA: piR-hsa-16
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 16751777 Journal Nature. 2006 Jul 13;442(7099):203-7.
Title A novel class of small RNAs bind to MILI protein in mouse testes
Authors Aravin A, Gaidatzis D, Pfeffer S, Lagos-Quintana M, Landgraf P, Iovino N, Morris P, Brownstein MJ, Kuramochi-Miyagawa S, Nakano T, Chien M, Russo JJ, Ju J, Sheridan R, Sander C, Zavolan M, Tuschl T.
PubMed 25818294 Journal Cell Rep. 2015 Mar 31;10(12):2069-82.
Title Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.
PubMed 27068805 Journal Sci Rep. 2016 Apr 12;6:24229. doi: 10.1038/srep24229.
Title Systematic characterization of seminal plasma piRNAs as molecular biomarkers for male infertility.
Authors Hong Y, Wang C, Fu Z, Liang H, Zhang S, Lu M, Sun W, Ye C, Zhang CY, Zen K, Shi L, Zhang C, Chen X.