Loading...
piRBase Id | piR-hsa-1519 | Accession | DQ571182 |
---|---|---|---|
Organism | Human | Number of methods | 1 |
Sequence | AGGATGCTTGATCCTGAAGGGTTAGCAGCA | Number of papers | 1 |
Length | 30 | Golden piRNA | - |
Aliases | piR-31294; PIR32293; |
No. | Location | Gene | RepeatMaker |
---|---|---|---|
Location 1 | 3:15044820-15044850:+ | NR2C2 ENST00000617312; NR2C2 ENST00000439011; NR2C2 ENST00000413194; MRPS25 ENST00000496484; |
No record. |
No record. |
No record. |
No record. |
Id in article | Disease | Subtype | Expression | Function | PubMed |
---|---|---|---|---|---|
piR-932 | Breast cancer | CD44+/CD24- | up-regulated | may be a positive regulator through promoting the methylation of Latexin | 23992744 |
PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
---|---|---|---|
Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. |
PubMed | 23992744 | Journal | Surg Oncol. 2013 Dec;22(4):217-23. doi: 10.1016/j.suronc.2013.07.001. Epub 2013 Aug 27. |
---|---|---|---|
Title | The expression of stem cell protein Piwil2 and piR-932 in breast cancer. | ||
Authors | Zhang H, Ren Y, Xu H, Pang D, Duan C, Liu C. |