Loading...

Detail Information of piRNA: piR-hsa-1519

General Information

piRBase Id	piR-hsa-1519	Accession	DQ571182
Organism	Human	Number of methods	1
Sequence	AGGATGCTTGATCCTGAAGGGTTAGCAGCA	Number of papers	1
Length	30	Golden piRNA	-
Aliases	piR-31294; PIR32293;

Datasets

Dataset	Accession	Reads	PubMed	Method	Tissue
1	N/A	N/A	16751776	small RNA	testis

Location in GRCh38

1 best hit(s) with 0 mismatch(es) in GRCh38

No.	Location	Gene	RepeatMaker
Location 1	3:15044820-15044850:+	NR2C2 ENST00000617312; NR2C2 ENST00000439011; NR2C2 ENST00000413194; MRPS25 ENST00000496484;

piRNA Expression

No record.

Target mRNA

No record.

Target lncRNA

No record.

Target Network

No record.

Disease Information

Id in article	Disease	Subtype	Expression	Function	PubMed
piR-932	Breast cancer	CD44+/CD24-	up-regulated	may be a positive regulator through promoting the methylation of Latexin	23992744

Reference

PubMed	16751776	Journal	Nature. 2006 Jul 13;442(7099):199-202.
Title	A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors	Girard A, Sachidanandam R, Hannon GJ, Carmell MA.

PubMed	23992744	Journal	Surg Oncol. 2013 Dec;22(4):217-23. doi: 10.1016/j.suronc.2013.07.001. Epub 2013 Aug 27.
Title	The expression of stem cell protein Piwil2 and piR-932 in breast cancer.
Authors	Zhang H, Ren Y, Xu H, Pang D, Duan C, Liu C.