Loading...

Detail Information of piRNA: piR-hsa-149416

General Information
piRBase Id piR-hsa-149416 Accession N/A
Organism Human Number of methods 2
Sequence AGTTGCAATACTTAATTTCTGCCA Number of papers 1
Length 24 Golden piRNA Y
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
167 GSM1584521 14 25818294 small RNA adult ovary
168 GSM1584522 6 25818294 small RNA adult ovary
169 GSM1584523 53 25818294 oxidized small RNA adult ovary
170 GSM1584524 38 25818294 oxidized small RNA adult ovary
171 GSM1584525 18 25818294 small RNA ovary from 1st trimester embryos
172 GSM1584526 18 25818294 small RNA ovary from 1st trimester embryos
173 GSM1584527 36 25818294 oxidized small RNA ovary from 1st trimester embryos
175 GSM1584529 10 25818294 small RNA ovary from 2nd trimester embryos
176 GSM1584530 1 25818294 small RNA ovary from 2nd trimester embryos
177 GSM1584531 25 25818294 oxidized small RNA ovary from 2nd trimester embryos
178 GSM1584532 19 25818294 oxidized small RNA ovary from 2nd trimester embryos
Location in GRCh38
1 best hit(s) with 1 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 1:630728-630752:+ ENSG00000230021 ENST00000419394; ENSG00000230021 ENST00000634337; ENSG00000230021 ENST00000635509; ENSG00000230021 ENST00000648019; ENSG00000230021 ENST00000440200; ENSG00000230021 ENST00000440196; ENSG00000230021 ENST00000641296; ENSG00000230021 ENST00000452176;
piRNA Expression
Sample CPM
GSM1584521 12.582
GSM1584522 4.1419
GSM1584523 50.4448
GSM1584524 33.1367
GSM1584525 11.3535
GSM1584526 11.6543
Sample CPM
GSM1584527 51.7814
GSM1584528 0
GSM1584529 4.4474
GSM1584530 0.4909
GSM1584531 3.0699
GSM1584532 23.8355
The Expression of piRNA: piR-hsa-149416
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 25818294 Journal Cell Rep. 2015 Mar 31;10(12):2069-82.
Title Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.