Loading...
piRBase Id | piR-hsa-149416 | Accession | N/A |
---|---|---|---|
Organism | Human | Number of methods | 2 |
Sequence | AGTTGCAATACTTAATTTCTGCCA | Number of papers | 1 |
Length | 24 | Golden piRNA | Y |
Aliases | N/A |
Dataset | Accession | Reads | PubMed | Method | Tissue |
---|---|---|---|---|---|
167 | GSM1584521 | 14 | 25818294 | small RNA | adult ovary |
168 | GSM1584522 | 6 | 25818294 | small RNA | adult ovary |
169 | GSM1584523 | 53 | 25818294 | oxidized small RNA | adult ovary |
170 | GSM1584524 | 38 | 25818294 | oxidized small RNA | adult ovary |
171 | GSM1584525 | 18 | 25818294 | small RNA | ovary from 1st trimester embryos |
172 | GSM1584526 | 18 | 25818294 | small RNA | ovary from 1st trimester embryos |
173 | GSM1584527 | 36 | 25818294 | oxidized small RNA | ovary from 1st trimester embryos |
175 | GSM1584529 | 10 | 25818294 | small RNA | ovary from 2nd trimester embryos |
176 | GSM1584530 | 1 | 25818294 | small RNA | ovary from 2nd trimester embryos |
177 | GSM1584531 | 25 | 25818294 | oxidized small RNA | ovary from 2nd trimester embryos |
178 | GSM1584532 | 19 | 25818294 | oxidized small RNA | ovary from 2nd trimester embryos |
No. | Location | Gene | RepeatMaker |
---|---|---|---|
Location 1 | 1:630728-630752:+ | ENSG00000230021 ENST00000419394; ENSG00000230021 ENST00000634337; ENSG00000230021 ENST00000635509; ENSG00000230021 ENST00000648019; ENSG00000230021 ENST00000440200; ENSG00000230021 ENST00000440196; ENSG00000230021 ENST00000641296; ENSG00000230021 ENST00000452176; |
Sample | CPM |
---|---|
GSM1584521 | 12.582 |
GSM1584522 | 4.1419 |
GSM1584523 | 50.4448 |
GSM1584524 | 33.1367 |
GSM1584525 | 11.3535 |
GSM1584526 | 11.6543 |
Sample | CPM |
---|---|
GSM1584527 | 51.7814 |
GSM1584528 | 0 |
GSM1584529 | 4.4474 |
GSM1584530 | 0.4909 |
GSM1584531 | 3.0699 |
GSM1584532 | 23.8355 |
No record. |
No record. |
No record. |
No record. |
PubMed | 25818294 | Journal | Cell Rep. 2015 Mar 31;10(12):2069-82. |
---|---|---|---|
Title | Piwi proteins and piRNAs in mammalian oocytes and early embryos. | ||
Authors | Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF. |