Loading...

Detail Information of piRNA: piR-hsa-140735

General Information
piRBase Id piR-hsa-140735 Accession N/A
Organism Human Number of methods 2
Sequence TCAGTAAGTTGCAATACTTAATTTCTGCCA Number of papers 1
Length 30 Golden piRNA Y
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
167 GSM1584521 3 25818294 small RNA adult ovary
168 GSM1584522 8 25818294 small RNA adult ovary
169 GSM1584523 20 25818294 oxidized small RNA adult ovary
170 GSM1584524 22 25818294 oxidized small RNA adult ovary
171 GSM1584525 17 25818294 small RNA ovary from 1st trimester embryos
172 GSM1584526 18 25818294 small RNA ovary from 1st trimester embryos
173 GSM1584527 33 25818294 oxidized small RNA ovary from 1st trimester embryos
175 GSM1584529 6 25818294 small RNA ovary from 2nd trimester embryos
176 GSM1584530 1 25818294 small RNA ovary from 2nd trimester embryos
177 GSM1584531 44 25818294 oxidized small RNA ovary from 2nd trimester embryos
178 GSM1584532 2 25818294 oxidized small RNA ovary from 2nd trimester embryos
Location in GRCh38
1 best hit(s) with 1 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 1:630722-630752:+ ENSG00000230021 ENST00000419394; ENSG00000230021 ENST00000634337; ENSG00000230021 ENST00000635509; ENSG00000230021 ENST00000648019; ENSG00000230021 ENST00000440200; ENSG00000230021 ENST00000440196; ENSG00000230021 ENST00000641296; ENSG00000230021 ENST00000452176;
piRNA Expression
Sample CPM
GSM1584521 2.6961
GSM1584522 5.5225
GSM1584523 19.0358
GSM1584524 19.1844
GSM1584525 10.7227
GSM1584526 11.6543
Sample CPM
GSM1584527 47.4663
GSM1584528 0
GSM1584529 2.6684
GSM1584530 0.4909
GSM1584531 5.403
GSM1584532 2.509
The Expression of piRNA: piR-hsa-140735
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 25818294 Journal Cell Rep. 2015 Mar 31;10(12):2069-82.
Title Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.