Loading...

Detail Information of piRNA: piR-hsa-13

General Information
piRBase Id piR-hsa-13 Accession N/A
Organism Human Number of methods 2
Sequence GAAGAAGACACTCCTGGAGGAGTCGGC Number of papers 2
Length 27 Golden piRNA -
Aliases PIR192563; PIR192361; PIR192388; PIR192435; PIR192465; PIR192503; PIR192538; PIR192605; PIR192637; PIR192670; PIR192705; PIR192765; PIR192798; PIR192854; PIR192895; PIR192956; PIR193009; PIR193064; PIR193099; PIR193147; PIR193157;
Datasets
Dataset Accession Reads PubMed Method Tissue
2 N/A N/A 16751777 small RNA testis
177 GSM1584531 3 25818294 oxidized small RNA ovary from 2nd trimester embryos
178 GSM1584532 1 25818294 oxidized small RNA ovary from 2nd trimester embryos
Location in GRCh38
21 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 15:101760991-101761018:+ DNM1P47 ENST00000561463; DNM1P47 ENST00000571780;
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
Sample CPM
GSM1584527 0
GSM1584528 0
GSM1584529 0
GSM1584530 0
GSM1584531 0.3684
GSM1584532 1.2545
The Expression of piRNA: piR-hsa-13
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751777 Journal Nature. 2006 Jul 13;442(7099):203-7.
Title A novel class of small RNAs bind to MILI protein in mouse testes
Authors Aravin A, Gaidatzis D, Pfeffer S, Lagos-Quintana M, Landgraf P, Iovino N, Morris P, Brownstein MJ, Kuramochi-Miyagawa S, Nakano T, Chien M, Russo JJ, Ju J, Sheridan R, Sander C, Zavolan M, Tuschl T.
PubMed 25818294 Journal Cell Rep. 2015 Mar 31;10(12):2069-82.
Title Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.