Loading...

Detail Information of piRNA: piR-hsa-1294871

General Information

piRBase Id	piR-hsa-1294871	Accession	N/A
Organism	Human	Number of methods	1
Sequence	GTTGCAATACTTAATTTCTGCCAC	Number of papers	1
Length	24	Golden piRNA	-
Aliases	N/A

Datasets

Dataset	Accession	Reads	PubMed	Method	Tissue
170	GSM1584524	1	25818294	oxidized small RNA	adult ovary

Location in GRCh38

1 best hit(s) with 1 mismatch(es) in GRCh38

No.	Location	Gene	RepeatMaker
Location 1	1:630729-630753:+	ENSG00000230021 ENST00000419394; ENSG00000230021 ENST00000634337; ENSG00000230021 ENST00000635509; ENSG00000230021 ENST00000648019; ENSG00000230021 ENST00000440200; ENSG00000230021 ENST00000440196; ENSG00000230021 ENST00000641296; ENSG00000230021 ENST00000452176;

piRNA Expression

Sample	CPM
GSM1584521	0
GSM1584522	0
GSM1584523	0
GSM1584524	0.872
GSM1584525	0
GSM1584526	0

Sample	CPM
GSM1584527	0
GSM1584528	0
GSM1584529	0
GSM1584530	0
GSM1584531	0
GSM1584532	0

The Expression of piRNA: piR-hsa-1294871

Loading...

P value calculation

Sample1

Sample2

Target mRNA

No record.

Target lncRNA

No record.

Target Network

No record.

Disease Information

No record.

Reference

PubMed	25818294	Journal	Cell Rep. 2015 Mar 31;10(12):2069-82.
Title	Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors	Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.