Loading...

Detail Information of piRNA: piR-hsa-12830

General Information
piRBase Id piR-hsa-12830 Accession DQ582607
Organism Human Number of methods 2
Sequence CCAAGGAGTTCATCTTCTCAGAGCTGC Number of papers 2
Length 27 Golden piRNA Y
Aliases piR-32719; PIR43718;
Datasets
Dataset Accession Reads PubMed Method Tissue
1 N/A N/A 16751776 small RNA testis
170 GSM1584524 1 25818294 oxidized small RNA adult ovary
173 GSM1584527 1 25818294 oxidized small RNA ovary from 1st trimester embryos
175 GSM1584529 3 25818294 small RNA ovary from 2nd trimester embryos
177 GSM1584531 23 25818294 oxidized small RNA ovary from 2nd trimester embryos
Location in GRCh38
64 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 15:101756333-101756360:+ DNM1P47 ENST00000561463; DNM1P47 ENST00000571780;
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
Sample CPM
GSM1584521 0
GSM1584522 0
GSM1584523 0
GSM1584524 0.872
GSM1584525 0
GSM1584526 0
Sample CPM
GSM1584527 1.4384
GSM1584528 0
GSM1584529 1.3342
GSM1584530 0
GSM1584531 2.8243
GSM1584532 0
The Expression of piRNA: piR-hsa-12830
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 25818294 Journal Cell Rep. 2015 Mar 31;10(12):2069-82.
Title Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.