Loading...

Detail Information of piRNA: piR-hsa-1245

General Information
piRBase Id piR-hsa-1245 Accession DQ570994
Organism Human Number of methods 2
Sequence AGCCCTGATGATGCCCACTCCTGAGC Number of papers 5
Length 26 Golden piRNA -
Aliases piR-31106; PIR32105;
Datasets
Dataset Accession Reads PubMed Method Tissue
1 N/A N/A 16751776 small RNA testis
3 N/A 4 22313525 small RNA epididymis
167 GSM1584521 2 25818294 small RNA adult ovary
168 GSM1584522 1 25818294 small RNA adult ovary
171 GSM1584525 7 25818294 small RNA ovary from 1st trimester embryos
172 GSM1584526 9 25818294 small RNA ovary from 1st trimester embryos
173 GSM1584527 2 25818294 oxidized small RNA ovary from 1st trimester embryos
175 GSM1584529 8 25818294 small RNA ovary from 2nd trimester embryos
176 GSM1584530 21 25818294 small RNA ovary from 2nd trimester embryos
177 GSM1584531 1 25818294 oxidized small RNA ovary from 2nd trimester embryos
300 GSM2222674 214 29516567 small RNA neuroblastoma cell lines (IMR-32)
301 GSM2222675 635 29516567 small RNA neuroblastoma cell lines (SH-SY-5Y)
320 GSM4020157 139 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Monolayer culture control
321 GSM4020158 109 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Monolayer culture control
322 GSM4020159 198 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Monolayer culture control
323 GSM4020160 135 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Monolayer culture control
324 GSM4020161 213 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Femal; Monolayer culture contro
325 GSM4020162 181 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Monolayer culture contr
326 GSM4020163 433 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Osteogenic differentiatio
327 GSM4020164 347 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Osteogenic differentiatio
328 GSM4020165 601 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Osteogenic differentiatio
329 GSM4020166 347 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Osteogenic differentiatio
330 GSM4020167 192 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Osteogenic differentiat
331 GSM4020168 171 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Osteogenic differentiat
332 GSM4020169 8 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Pellet culture control (d
333 GSM4020170 42 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Pellet culture control (d
334 GSM4020171 15 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Pellet culture control (d
335 GSM4020172 11 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Pellet culture control (d
336 GSM4020173 11 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Pellet culture control
337 GSM4020174 10 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Pellet culture control
338 GSM4020175 85 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Chondrogenic differentiat
339 GSM4020176 115 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Chondrogenic differentiat
340 GSM4020177 36 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Chondrogenic differentiat
341 GSM4020178 73 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Chondrogenic differentiat
342 GSM4020179 53 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Chondrogenic differenti
343 GSM4020180 56 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Chondrogenic differenti
Location in GRCh38
1 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 9:137013749-137013775:- ABCA2 ENST00000614293; ABCA2 ENST00000371605; ABCA2 ENST00000265662; ABCA2 ENST00000341511; ABCA2 ENST00000479446; ABCA2 ENST00000487109; ABCA2 ENST00000459850; ABCA2 ENST00000488535;
piRNA Expression
Sample CPM
GSM1584521 1.7974
GSM1584522 0.6903
GSM1584523 0
GSM1584524 0
GSM1584525 4.4152
GSM1584526 5.8271
Sample CPM
GSM1584527 2.8767
GSM1584528 0
GSM1584529 3.5579
GSM1584530 10.3084
GSM1584531 0.1228
GSM1584532 0
The Expression of piRNA: piR-hsa-1245
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
Id in article Disease Subtype Expression Function PubMed
piR-31106 Breast cancer up-regulated 25313140
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22313525 Journal Gene. 2012 Apr 15;497(2):330-5.
Title Deep sequencing analysis of small non-coding RNAs reveals the diversity of microRNAs and piRNAs in the human epididymis.
Authors Li Y, Wang HY, Wan FC, Liu FJ, Liu J, Zhang N, Jin SH, Li JY.
PubMed 25818294 Journal Cell Rep. 2015 Mar 31;10(12):2069-82.
Title Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.
PubMed 29516567 Journal Genes Chromosomes Cancer. 2018 Jul;57(7):339-349. doi: 10.1002/gcc.22535.
Title Investigating piwi-interacting RNA regulome in human neuroblastoma.
Authors Roy J, Mallick B.
PubMed 32050423 Journal Cells. 2020 Feb 9;9(2):398. doi: 10.3390/cells9020398.
Title Differential Regulation of circRNA, miRNA, and piRNA during Early Osteogenic and Chondrogenic Differentiation of Human Mesenchymal Stromal Cells.
Authors Della Bella E, Menzel U, Basoli V, Tourbier C, Alini M, Stoddart MJ.
PubMed 25313140 Journal Oncotarget. 2014 Oct 30;5(20):9901-10.
Title RNA sequencing identifies specific PIWI-interacting small non-coding RNA expression patterns in breast cancer
Authors Hashim A, Rizzo F, Marchese G, Ravo M, Tarallo R, Nassa G, Giurato G, Santamaria G, Cordella A, Cantarella C, Weisz A.