Loading...
piRBase Id | piR-hsa-11064 | Accession | DQ580838 |
---|---|---|---|
Organism | Human | Number of methods | 2 |
Sequence | TGAGGACCTGAGGTCGTAGGTGGATC | Number of papers | 2 |
Length | 26 | Golden piRNA | - |
Aliases | piR-48950; PIR41949; |
Dataset | Accession | Reads | PubMed | Method | Tissue |
---|---|---|---|---|---|
1 | N/A | N/A | 16751776 | small RNA | testis |
268 | GSM3517637 | N/A | 31358756 | samll RNA(CAS-seq) | oocyte(age: adult) |
274 | GSM3517644 | N/A | 31358756 | samll RNA(CAS-seq) | 2 cell embryo(age: adult; spike in) |
286 | GSM3517671 | N/A | 31358756 | oxidized small RNA | oocyte(age: adult; spike in) |
No. | Location | Gene | RepeatMaker |
---|---|---|---|
Location 1 | CHR_HSCHR19LRC_PGF2_CTG3_1:54749705-54749731:+ | ||
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC |
No record. |
No record. |
No record. |
No record. |
No record. |
PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
---|---|---|---|
Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. |
PubMed | 31358756 | Journal | Nat Commun. 2019 Jul 29;10(1):3389. doi: 10.1038/s41467-019-11312-8. |
---|---|---|---|
Title | Single-cell CAS-seq reveals a class of short PIWI-interacting RNAs in human oocytes. | ||
Authors | Yang Q, Li R, Lyu Q, Hou L, Liu Z, Sun Q, Liu M, Shi H, Xu B, Yin M, Yan Z,Huang Y, Liu M, Li Y, Wu L. |