Loading...

Detail Information of piRNA: piR-hsa-11064

General Information
piRBase Id piR-hsa-11064 Accession DQ580838
Organism Human Number of methods 2
Sequence TGAGGACCTGAGGTCGTAGGTGGATC Number of papers 2
Length 26 Golden piRNA -
Aliases piR-48950; PIR41949;
Datasets
Dataset Accession Reads PubMed Method Tissue
1 N/A N/A 16751776 small RNA testis
268 GSM3517637 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult)
274 GSM3517644 N/A 31358756 samll RNA(CAS-seq) 2 cell embryo(age: adult; spike in)
286 GSM3517671 N/A 31358756 oxidized small RNA oocyte(age: adult; spike in)
Location in GRCh38
242 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 CHR_HSCHR19LRC_PGF2_CTG3_1:54749705-54749731:+
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
No record.
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 31358756 Journal Nat Commun. 2019 Jul 29;10(1):3389. doi: 10.1038/s41467-019-11312-8.
Title Single-cell CAS-seq reveals a class of short PIWI-interacting RNAs in human oocytes.
Authors Yang Q, Li R, Lyu Q, Hou L, Liu Z, Sun Q, Liu M, Shi H, Xu B, Yin M, Yan Z,Huang Y, Liu M, Li Y, Wu L.